Lightshift chemiluminescence kit

The upstream regions of the toxP, cbuA0029, and groEL genes were first selected for PCR amplification. PCR products (1 μg) of desired templates were 3′ end‐labeled using a Pierce biotin 3′ End DNA Labeling Kit (Thermo Scientific). The resulting probe reaction mixtures were electrophoresed on a 0.8% agarose gel for 30 min at 100 V and then gel purified with a NucleoSpin Gel and PCR Clean‐up kit (Takara Bio USA). The EMSA binding reaction, consisting of 2.5% glycerol, 5 mM MgCl2, 50 mM KCl, 1 nM biotin‐labeled DNA, and varying concentrations of either ToxP or AntitoxP/ToxP in 1X Binding Buffer (LightShift Chemiluminescence kit; Thermo Scientific), was assembled and incubated at room temperature for 30 min. A nondenaturing loading dye (0.25% bromophenol blue) was added, and the resulting RNA mixtures were resolved on a 10% polyacrylamide gel for 2 h at 100 V. DNA/protein complexes were transferred to a Hybond‐N+ positively charged nylon membrane (Amersham Pharmacia Biotech) using an electroblot transfer system (Bio‐Rad) and cross‐linked with short‐wave UV light in a GS gene linker UV chamber (Bio‐Rad). A North2South chemiluminescence hybridization and detection kit (Thermo Scientific) was used to detect resulting bands. The blot was imaged on a UVP ChemStudio PLUS Imager (Analytik Jena).

Two primers, Fur-A (5′-TTTAGGCGTGGCAATTCTATAATGA-3′ labeled with biotin at 5′-end) and Fur-B (5′-TATCAGTCATGCGGAATCTGTCCTG-3′) (Integrated DNA Technologies co), were used for the PCR amplification of the E. coli fur promoter region: (5′-TTTAGGCGTGGCAATTCTATAATGATACGCATTATCTCAAGAGCAAATTCTGTCACTTCTTCTAATGAAGTGAACCGCTTAGTAACAGGACAGATTCCGCATGACTGATA-3′) (110 bp). The highlighted sequence represents the consensus Fur-box (4 (link)). The biotin-labeled fur promoter fragment (0.7 nM) was incubated with increasing concentrations of Fur (0–2.0 μM) in 18 μl solutions containing Tris (22 mM, pH 8.0), glycerol (7%), MgCl₂ (4.1 mM), KCl (44 mM), and NaCl (55 mM) at room temperature for 10 min and subjected to nondenaturing polyacrylamide gel (4%) electrophoresis. The biotin-labeled DNA fragments on the polyacrylamide gel were transferred to a nylon membrane (0.45 μm) (Thermo Fisher Scientific co), cross-linked under UV light at 120 mJ/cm² for 1 min, and visualized using the Lightshift Chemiluminescence kit (Thermo Fisher Scientific co). The intensities of the Fur/DNA complex bands on the gel images were quantified using ImageJ (NIH).