Log In Sign up
The largest database of trusted experimental protocols

S adenosylmethionine

Manufactured by New England Biolabs
Visit Supplier
Sourced in United States

S-adenosylmethionine is a naturally occurring compound that serves as a methyl group donor in various biological reactions. It is an essential cofactor for numerous enzymes involved in methylation processes, including the methylation of DNA, RNA, proteins, and other molecules. S-adenosylmethionine plays a crucial role in cellular metabolism, gene expression regulation, and other important physiological functions.

Automatically generated - may contain errors

Lab products found in correlation

Cpg methyltransferase m sssi, by New England Biolabs (5 mentions) M sssi, by New England Biolabs (4 mentions) Hpaii, by New England Biolabs (4 mentions) Anti h3k27me3 antibody, by Cell Signaling Technology (2 mentions) Ezh2 inhibitor gsk126, by Merck Group (2 mentions) Nucleosome, by New England Biolabs (2 mentions) M sssi methylase, by New England Biolabs (2 mentions) Dam methylase, by New England Biolabs (2 mentions) Trizol reagent, by Thermo Fisher Scientific (2 mentions) Lipofectamine 3000 reagent, by Thermo Fisher Scientific (2 mentions) Nucleoside digestion mix, by New England Biolabs (1 mentions) Competent e coli cells, by New England Biolabs (1 mentions) Codon optimized synthetic gene, by Integrated DNA Technologies (1 mentions) Dna oligonucleotide, by Integrated DNA Technologies (1 mentions) T4 dna ligase, by New England Biolabs (1 mentions) Restriction endonuclease, by New England Biolabs (1 mentions) P3000 reagent, by Thermo Fisher Scientific (1 mentions) Prl tk renilla luciferase control reporter vector, by Promega (1 mentions) Pgl3 basic vector, by New England Biolabs (1 mentions) Sssi methylase, by New England Biolabs (1 mentions)

41 protocols using s adenosylmethionine

1

Methylation Analysis of NDRG2 Promoter

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Bisulfite treatment of genomic DNA was performed as previously described[33 (link)], using glycogen as carrier, and the precipitated DNA was redissolved in TE buffer, amplified by PCR and sequenced directly. The primers were designed to cover 16 CpG sites in the promoter region in NDRG2 (Figure 1A) and their sequences were (5’-3’): TTTTCGAGGGGTATAAGGAGAGTTTATTTT and CCAAAAACTCTAACTCCTAAATAAACA[34 (link)]. A positive control with in vitro methylated (IVM) DNA was prepared by mixing 2 μL NEB2 buffer, 1 μL 20 x S-adenosylmethionine (New England Biolabs, B9003S), 200 ng reference human genomic DNA and 1 µL SssI methyltransferase (New England BioLabs, M0226S) in a total of 20 μL. Samples were incubated at 37 °C overnight with occasional addition of 2 μL 20 x S-adenosylmethionine to ensure sufficient methyl-donor substrate. The following description was used for each CpG site: Unmethylated (no methylation signal); weakly methylated (methylation signal was less than or approximately equal to unmethylated signal); and strongly methylated (methylation signal was greater than unmethylated signal).
Lorentzen A, & Mitchelmore C. (2017). NDRG2 gene copy number is not altered in colorectal carcinoma. World Journal of Clinical Oncology, 8(1), 67-74.
+ Open protocol
+ Expand
2

Chaer impact on PRC2 histone methyltransferase

Check if the same lab product or an alternative is used in the 5 most similar protocols
To test the impact of Chaer on PRC2 activity, we performed the histone methyltranferase activity assay as previously described66 (link). Reactions were carried out in a volume of 50 μl and contained 2 pmol nucleosome (New England Biolabs, MA, USA), 2 pmol PRC2 complex, 10 mM HEPES (pH 7.9), 0.25 mM EDTA, 200 mM NaCl, 10% glycerol, 2 mM dithiothreitol, 2.5 mM MgCl2 and 0.8 μM S-adenosyl-methionine (New England Biolabs, MA, USA) with and without 10 nM Chaer RNA or 200 nM Ezh2 inhibitor GSK126 (Merck Millipore, Darmstadt, Germany). Reactions were incubated for 2 h at 30°C, and resolved by SDS–polyacrylamide gel electrophoresis followed by immunoblotting using anti-H3K27me3 antibody (Cell Signaling Technologies, MA, USA; #9756, 1:1000).
Wang Z., Zhang X.J., Ji Y.X., Zhang P., Deng K.Q., Gong J., Ren S., Wang X., Chen I., Wang H., Gao C., Yokota T., Ang Y.S., Li S., Cass A., Vondriska T.M., Li G., Deb A., Srivastava D., Yang H.T., Xiao X., Li H, & Wang Y. (2016). A Long Non-Coding RNA Defines an Epigenetic Checkpoint in Cardiac Hypertrophy. Nature medicine, 22(10), 1131-1139.
+ Open protocol
+ Expand
3

Molecular Biology Toolkit for Genetic Engineering

Check if the same lab product or an alternative is used in the 5 most similar protocols
Restriction endonucleases, T4-DNA ligase, Phusion-HF and Q5 DNA polymerases, Gibson and HiFi assembly reagents, S-adenosylmethionine, Nucleoside Digestion Mix and competent E. coli cells were from New England Biolabs (Ipswich, MA, USA). Plasmid DNAs and PCR products were purified using spin-column reagents from New England Biolabs. DNA oligonucleotides (for use in PCR or DNA sequencing applications) and a codon-optimized synthetic gene were purchased from Integrated DNA Technologies (Coralville, IA, USA). Genomic DNAs of D. thermolithotrophum and F. nodosum Rt17-B1 were purchased from the DSMZ-German Collection of Microorganisms and Cell Cultures GmbH.
Murray I.A., Luyten Y.A., Fomenkov A., Dai N., Corrêa IR J.r., Farmerie W.G., Clark T.A., Korlach J., Morgan R.D, & Roberts R.J. (2021). Structural and functional diversity among Type III restriction-modification systems that confer host DNA protection via methylation of the N4 atom of cytosine. PLoS ONE, 16(7), e0253267.
+ Open protocol
+ Expand
4

Methylation of CIRBP by PRMT1

Check if the same lab product or an alternative is used in the 5 most similar protocols
Untagged CIRBPRGG and full-length CIRBP recombinant proteins and His6-PRMT1 were equilibrated in methylation buffer containing 50 mM Na-phosphate, pH 8, 150 mM NaCl, and 2 mM Tris(2-carboxyethyl)phosphine; 50 µM CIRBPRGG or full-length CIRBP was incubated with 7 µM His6-PRMT1 in the presence of 2 mM S-Adenosylmethionine (New England Biolabs) for 16 h at room temperature. Untagged methylated CIRBPRGG (meCIRBPRGG) and full-length CIRBP (meCIRBP) were then isolated from PRMT1 performing a second affinity purification using Ni-NTA beads, further equilibrated in the buffer of interest, and analyzed using NMR (SI Appendix).
Bourgeois B., Hutten S., Gottschalk B., Hofweber M., Richter G., Sternat J., Abou-Ajram C., Göbl C., Leitinger G., Graier W.F., Dormann D, & Madl T. (2020). Nonclassical nuclear localization signals mediate nuclear import of CIRBP. Proceedings of the National Academy of Sciences of the United States of America, 117(15), 8503-8514.
+ Open protocol
+ Expand
5

Methylation of Fluorinated DNA Substrates

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
To generate pDPCTop and pDPCBot, we cloned 5′-CCTCAGCATCCGGTACCTCAGC-3′ between the EcoRI and NdeI sites of pUC.HSO (Wold et al., 1987 (link)) to generate pHY10 (Yardimci et al., 2012 (link)). We then inserted a 5-fluoro-2′-deoxycytidine (Cfluo)-modified oligonucleotide (Biosynthesis, Lewisville, TX) into either strand. pHY10 was either nicked with Nt.BbvCI and annealed/ligated to 5′-TCAGCATCCfluoGGTACC-3′ to modify the top strand, or nicked with Nb.BbvCI and annealed/ligated to 5′-TGAGGTACCfluoGGATGC-3′ to modify the bottom strand. Modified DNA was gel-purified and mixed with M.HpaII-His6 or M.HpaII-biotin-His6 in reaction buffer (50 mM Tris-HCl, pH 7.5, 5 mM 2-mercaptoethanol, 10 mM EDTA) supplemented with 100 μM S-adenosylmethionine (NEB, Ipswich, MA) for 12 hours at 37 °C. To make pCTRL, the plasmid containing the fluorinated cytosine on the top strand was used in an identical reaction without M.HpaII.
Duxin J.P., Dewar J.M., Yardimci H, & Walter J.C. (2014). Repair of a DNA-protein crosslink by replication-coupled proteolysis. Cell, 159(2), 346-357.
+ Open protocol
+ Expand
6

HOTAIR Epigenetic Regulation in Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
HOTAIR gene was cloned into expression vector pEGFP-N1. In vitro DNA methylation was performed by CpG Methyltransferase (M.SssI) (New England Biolabs, Ipswich, MA, USA) in the presence of 320 μM S-adenosylmethionine (New England Biolabs). pEGFP-N1 with HOTAIR being methylated was transfected in Cos7 cells and HPDE cells using Lipofectamine 3000 Reagent (Thermo Fisher Scientific) and P3000 Reagent (Thermo Fisher Scientific). RNA was extracted by TRIzol Reagent (ThermoFisher) and analyzed by qRT-PCR.
Wong C.H., Li C.H., Man Tong J.H., Zheng D., He Q., Luo Z., Lou U.K., Wang J., To K.F, & Chen Y. (2022). The establishment of CDK9/RNA PolII/H3K4me3/DNA methylation feedback promotes HOTAIR expression by RNA elongation enhancement in cancer. Molecular Therapy, 30(4), 1597-1609.
+ Open protocol
+ Expand
7

Methylation Analysis of 5.8S Amplicon

Check if the same lab product or an alternative is used in the 5 most similar protocols
An unmethylated DNA template for the 5.8S amplicon was obtained by PCR on genomic DNA (primer sequences: forward cccgtggtgtgaaacctt, reverse agctagctgcgttcttcatc). The PCR product was then in vitro methylated in a buffer containing 60ng DNA/μL, 0.16 mM S-adenosylmethionine and 0.8 unit M.SssI/μL (New England Biolabs) at 37°C for 2 h followed by M.SssI inactivation at 65°C for 20’. Methylated and unmethylated templates were used for qPCR with the 5.8S amplicon primers. To verify the extent of methylation, both methylated and unmethylated templates were incubated with the methyl sensitive restriction enzyme HpaII. Template resistance to HpaII was determined by qPCR.
Hallgren J., Pietrzak M., Rempala G., Nelson P.T, & Hetman M. (2014). Neurodegeneration-associated instability of ribosomal DNA. Biochimica et biophysica acta, 1842(6), 860-868.
+ Open protocol
+ Expand
8

Construction and Methylation of Zta Vectors

Check if the same lab product or an alternative is used in the 5 most similar protocols
A cDNA3-based expression vector for Zta that includes a hexa-histidine tag at the amino terminus (hisZta), together with its control vector, was used [62 (link)]. The BNLF2a promoter was cloned into the pCpGL-basic expression vector using BamHI and HindIII [63 (link)]. The sequence coordinates for the BNLF2a promoter are 167029–167941 referring to the Human herpesvirus 4 type 1, complete genome NCBI Reference Sequence: NC_007605.1. The TATA box is located between 167062 and 167067. A BamHI site was introduced at the distal and a HindIII site at the promoter proximal end using gene synthesis. For each of the ZRE mutations the ZRE was mutated to CCCCTTT (distal to proximal). For DNA methylation experiments, the relevant plasmids were incubated with or without CpG methyltransferase (M.SssI) in the presence of 160 µM S-adenosylmethionine for 1 h at 37 °C as recommended by the manufacturer (New England Biolabs), then purified using a plasmid mini clean-up column (Qiagen).
The His-tagged GST-Zta expression vector was generated by cloning the coding region for Zta (aa 168–245) into the pOPINJ vector [a gift from Ray Owens (Addgene plasmid #26045)].
Almohammed R., Osborn K., Ramasubramanyan S., Perez-Fernandez I.B., Godfrey A., Mancini E.J, & Sinclair A.J. (2018). Mechanism of activation of the BNLF2a immune evasion gene of Epstein-Barr virus by Zta. The Journal of General Virology, 99(6), 805-817.
+ Open protocol
+ Expand
9

Methylation Analysis of CX3CR1 Gene Promoter

Check if the same lab product or an alternative is used in the 5 most similar protocols
To generate the CX3CR1 gene promoter construct (pGL3-CX3CR1), the CX3CR1 gene promoter region was amplified from genomic DNA using high-fidelity DNA polymerase (Invitrogen Life Technologies), cloned into pGL3-basic vector (Promega, Madison, WI) and verified by sequencing. In methylating the CX3CR1 promoter construct, the pGL3-CX3CR1 construct and pGL3-basic vector were incubated for 1 hour at 37°C in the presence or absence of SssI methylase (New England Biolabs, Beverly, MA) with 80 μM S-adenosylmethionine (New England Biolabs). Methylated and unmethylated constructs were purified using a Qiagen PCR purification kit (Qiagen) and transfected into 293 T cells using lipofectamine (Invitrogen Life Technologies) according to the manufacturer’s instructions. The pRL-TK (Renilla luciferase control reporter vector, Promega) was co-transfected as an internal control for transfection efficiency. Transfected cells were harvested after 24 hours and analyzed according to the manufacturer’s instructions for luciferase and Renilla activities.
Shin M.S., You S., Kang Y., Lee N., Yoo S.A., Park K., Kang K.S., Kim S.H., Mohanty S., Shaw A.C., Montgomery R.R., Hwang D, & Kang I. (2015). DNA methylation regulates the differential expression of CX3CR1 on human IL-7Rαlow and high effector memory CD8+ T cells with distinct migratory capacities to fractalkine. Journal of immunology (Baltimore, Md. : 1950), 195(6), 2861-2869.
+ Open protocol
+ Expand
10

Chaer impact on PRC2 histone methyltransferase

Check if the same lab product or an alternative is used in the 5 most similar protocols
To test the impact of Chaer on PRC2 activity, we performed the histone methyltranferase activity assay as previously described66 (link). Reactions were carried out in a volume of 50 μl and contained 2 pmol nucleosome (New England Biolabs, MA, USA), 2 pmol PRC2 complex, 10 mM HEPES (pH 7.9), 0.25 mM EDTA, 200 mM NaCl, 10% glycerol, 2 mM dithiothreitol, 2.5 mM MgCl2 and 0.8 μM S-adenosyl-methionine (New England Biolabs, MA, USA) with and without 10 nM Chaer RNA or 200 nM Ezh2 inhibitor GSK126 (Merck Millipore, Darmstadt, Germany). Reactions were incubated for 2 h at 30°C, and resolved by SDS–polyacrylamide gel electrophoresis followed by immunoblotting using anti-H3K27me3 antibody (Cell Signaling Technologies, MA, USA; #9756, 1:1000).
Wang Z., Zhang X.J., Ji Y.X., Zhang P., Deng K.Q., Gong J., Ren S., Wang X., Chen I., Wang H., Gao C., Yokota T., Ang Y.S., Li S., Cass A., Vondriska T.M., Li G., Deb A., Srivastava D., Yang H.T., Xiao X., Li H, & Wang Y. (2016). A Long Non-Coding RNA Defines an Epigenetic Checkpoint in Cardiac Hypertrophy. Nature medicine, 22(10), 1131-1139.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!