U87 cells were seeded in a 100-mm cell culture dish for 24 h, and treated with 0, 10, 50 and 150 µM taraxerol acetate for 48 h. The cells were harvested and washed with PBS, and the pellets were lysed with 400 µl DNA lysis buffer (2% NP-40, 20 mM EDTA and 40 mM Tris-HCl; Sigma-Aldrich) for 30 min. Subsequent to centrifugation at 6,600 × g for 5 min, the supernatants were prepared in an equal volume of 1.5% sodium-dodecyl sulphate (SDS; Siamg-Aldrich), incubated with 2.5 mg/ml RNase A at 60°C for 2 h followed by digestion with 2.5 mg/ml proteinase K (Sigma-Aldrich) for 2 h at 20°C. Following the addition of 0.5 volumes of 10 M ammonium acetate (Sigma-Aldrich), the DNA was precipitated with cold ethanol and collected by centrifugation at 6,600 × g for 20 min. DNA was then dissolved in gel loading buffer (Sigma-Aldrich), separated by electrophoresis in 1.5% agarose gel (1 h at 100 V) and visualized under ultraviolet light, following EB staining.
Gel loading buffer
Manufactured by Merck Group
Sourced in Japan, France
Gel loading buffer is a solution used in molecular biology to prepare samples for DNA or RNA electrophoresis. Its core function is to increase the density of the sample and add tracking dyes, allowing the sample to sink into the gel and be easily visualized during the electrophoresis process.
Automatically generated - may contain errors
Lab products found in correlation
Puc18, by Thermo Fisher Scientific (2 mentions)
Rnase a, by Merck Group (1 mentions)
Proteinase k, by Merck Group (1 mentions)
Agarose, by Merck Group (1 mentions)
Tris acetate edta buffer, by Merck Group (1 mentions)
Directload pcr 100 bp low ladder, by Merck Group (1 mentions)
Protease inhibitory cocktail, by Roche (1 mentions)
Neutravidin agarose beads, by Thermo Fisher Scientific (1 mentions)
Sulfo nhs ss biotin, by Thermo Fisher Scientific (1 mentions)
Protease inhibitor cocktail, by Roche (1 mentions)
Zetapals instrument, by Brookhaven Instruments (1 mentions)
Multiimage 2 alphaimager hp, by Bio-Techne (1 mentions)
Dimension fastscan afm, by Bruker (1 mentions)
Eos 50d, by Canon (1 mentions)
50 bp dna ladder, by Takara Bio (1 mentions)
Gelred nucleic acid gel stain, by Biotium (1 mentions)
S75 3, by Lipoid (1 mentions)
Solutol hs15, by Lipoid (1 mentions)
Propidium iodide, by Merck Group (1 mentions)
Sodium chloride (nacl), by Merck Group (1 mentions)
9 protocols using gel loading buffer
1
Taraxerol Acetate Induces Apoptosis in U87 Cells
2
Agarose Gel Electrophoresis Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The PCR products were tested for amplification of specific genes by agarose gel electrophoresis using 2.0% agarose gel in ×1 Tris-acetate EDTA Buffer (Sigma-Aldrich). A total volume of 60 mL of 2.0% agarose (Sigma-Aldrich) was prepared in ×1 Tris-acetate EDTA Buffer and placed in microwave oven until melted. Molten agarose was allowed to cool to about 55°C and ethidium bromide was added to give a final concentration of 0.5 µg/mL. The gel was poured onto electrophoresis through fitted with a comb. The gel was allowed to set on a flat surface for about 15 min. Electrophoresis was placed in an electrophoresis tank filled with ×1 Tris-acetate EDTA Buffer. Samples were prepared on a parafilm by mixing 2 µL of Gel Loading Buffer (Sigma-Aldrich) and 8 µL of PCR products were loaded in parallel with 100 bp ladder (Direct load PCR 100 bp low ladder, Sigma-Aldrich). Electrophoresis was done at 70 volts for 10 min, then at 50 volts for 2 h. Gel was viewed under an ultraviolet transilluminator and photographed with gel documentation system (BIO RAD Gel Doc EZ Images, USA) for future analysis.
3
Biotinylation and Enrichment of Cell Surface Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Transfected HEK cells or primary cultures of cortical neurons at 15 or 22-23 days in vitro (DIV) were washed 3 times in ice-cold PBS supplemented with 0.8 mM CaCl2 and 0.5 mM MgCl2 (PBS2+) and then incubated for 12 min at room temperature followed by further 12 min at 4°C with 1 mg/ml Sulfo-NHS-SS-Biotin (ThermoFisher Scientific) in PBS2+. After rinsing in ice-cold PBS2+, biotin was quenched in 50 mM glycine in PBS2+ for 10 min. Cells were scraped in NaCl-Tris buffer supplemented with protease inhibitory cocktail (Roche) and then lysed (150 mM NaCl, 50 mM TrisHCl, 2% Triton X-100, 2 mM EDTA, 1 mM PMSF, protease inhibitor cocktail) for 1 h at 4°C. Biotinylated proteins were pulled down by incubating cell lysates with neutravidin agarose beads (ThermoFisher Scientific) for 2 h at 4°C. After extensive washes, beads were resuspended in gel loading buffer (Sigma-Aldrich) and bound proteins were eluted with boiling. Relative cell surface expression levels were analyzed by western blotting. Inputs correspond to 20% of the cell surface fraction.
4
Ouabain-Induced DNA Fragmentation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells treated at 37°C with different concentrations (0, 10, 20, 40 nM) of ouabain for 48 h, cells were collected and treated for 10 sec with lysis buffer (50 mM Tris-Cl, 150 mM NaCl, 1% nonylphenoxypolyethoxyl ethanol, 1% sodium deoxycholate and 1% SDS) at room temperature (RT). Supernatant was collected by centrifugation for 5 min at 14,000 × g, 1% SDS was added and samples were then treated with ribonuclease A for 2 h at 56°C followed by digestion with proteinase K for at least 2 h at 37°C. Subsequently, 0.5 volume 10 M ammonium acetate was added, the DNA was precipitated with 2.5 volume ethanol, dissolved in gel loading buffer (Sigma-Aldrich; Merck KGaA) and separated by electrophoresis on 1% agarose gels.
5
Characterization of Plasmid-Laden 4-Arm PRX
6
Agarose Gel Electrophoresis for DNA Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Agarose (1.5 g) was dissolved in 100 mL TBE (54 g Tris base, 27.5 g boric acid, 4.14 g ethylene diamine tetraacetic acid, pH = 8.0–8.2) by heating for 2 min, then mixed with 10 μL Gel Red™ nucleic acid gel stain (Biotium, Fremont, CA, USA) to obtain a 1.5% agarose gel. A 10 μL aliquot of the product of primer amplification was mixed with 2 μL gel loading buffer (Sigma), then the mixture and 10 μL DNA marker (50 bp DNA Ladder, Takara Bio Inc., Shiga, Japan) were added into the loading wells of the gel. Gel electrophoresis was performed on a nucleic acid electrophoresis apparatus (BIO-RAD) at 100 V for 90 min. Finally, the gel was photographed using a Canon digital camera (EOS50D, Canon, Tokyo, Japan).
7
Formulation and Characterization of Taxol Nanoparticles
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Lipoid® S75-3 (soybean lecithin at 69% of phosphatidylcholine), Captex® 8000 (glyceryltricaprylate) and Solutol® HS15 (polyethyleneglycol ester of 12-hydroxystearic acid and polyethylene glycol-PEG-SA) were obtained from Lipoid GmbH (Ludwigshafen, Germany), Abitec Corp (Colombus, OH, USA) and BASF (Ludwigshafen, Germany), respectively. Ethanol Solution 96% was purchased from Fisher Scientific (Illkirch, France). Taxol® 6mg/ml solution and PTX powder were supplied by Bristol-Myers Squibb (Rueil-Malmaison, France) and LC Laboratories® (Woburn, MA 01801, USA), respectively. Sodium chloride, sodium dodecyl sulphate (SDS), chitosan low molecular weight (average Mn 5,000 Da, > 90% deacetylated), propidium iodide, bis-chloroethylnitrosourea (BCNU) and gel loading buffer were purchased from Sigma Aldrich (Saint-Quentin-Fallavier, France). CpG-ODN: Phosphorothioated-CpG-oligodeoxynucleotide 1826, seq (5'-3': tccatgacgttcctgacgtt) (CpG) was purchased from Invivogen (Toulouse, France). Annexin V-FITC was purchased from BD Pharmingen (San Diego, CA, USA).
8
Characterizing telRL-Containing Plasmid Structures
9
Characterizing telRL-Containing Plasmid Structures
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Two different telRL-containing plasmids were constructed to investigate the ability of TelN to cleave DNA to produce the hairpin ends. The commercially available Luciferase-encoding plasmid pGL4.13 (Promega) was modified to include 2 telRL sequences flanking the Luciferase cassette. It was hereafter named pGL DOG with the Doggybone created from this construct called DB GL. A PCR-amplified version of the pGL DOG cassette (PCR GL) incorporating the telRL-flanked expression region was created. pUC18 telRL was created by the addition of a telRL site into the HindIII and BamHI sites of pUC18 (Thermo Scientific).
Doggybone and linear DNA constructs were run on native and denaturing gels.Native gel 100ng of each sample mixed with 6X gel loading buffer (Sigma) was run on a 0.8% agarose in TAE gel run in 1xTAE. Denaturing gel 500ng of each sample was mixed with 6X denaturing sample buffer (300mM NaOH, 6mM EDTA, 18% Ficoll, 0.15% bromocresol green, 0.25% xylene cyanol). The samples were then run on a 1% agarose (in H2O) at 10V in denaturing running buffer (50mM NaOH, 0.1mM EDTA) overnight on ice to minimize overheating. Once sufficiently separated the gel neutralized for 30 min in 1M Tris HCl pH 7.6, 1.5M NaCl. Both gels were stained for DNA with ethidium bromide and visualized under UV light.
Doggybone and linear DNA constructs were run on native and denaturing gels.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!