Quantstudio 7 pcr system

Total RNA was isolated using a miRNeasy mini kit (Qiagen) and reverse-transcribed into cDNA with the SuperScript III kit (Life Technologies) as described previously [26 (link)]. For miR-182 expression analysis, cDNA was synthesized from total RNA with the TaqMan Reverse Transcription kit (Applied Biosystems) with specific primers and the cDNA was subjected to TaqMan Probe-based Real-Time PCR using TaqMan miRNA assays Universal PCR Master Mix (Thermo Fisher Scientific) according to the manufacturer’s instructions. Real-time reverse transcription-polymerase chain reaction (RT–PCR) was performed with SYBR Green (Applied Biosystems) using a QuantStudio 7 PCR System. The expression levels of miRNA were calculated as the amount of target miRNA relative to that of RNU48 control to normalize the initial input of total RNA.

Samples were treated with DNase I (New England Biolabs, Ipswich, MA, USA) to remove free DNA and with Proteinase K (Invitrogen, Waltham, MA, USA) to break down AAV capsids. Viral DNA was amplified using quantitative polymerase chain reaction (qPCR) with a set of primers and TaqMan probe (5′ 6‐FAM/ 3’ BHQ‐1, Millipore‐Sigma) targeting AAV inverted terminal repeats (ITRs) using the QuantStudio 7 PCR System (Applied Biosystems, Waltham, MA, USA). Purified linearized transgene plasmid was used as a standard to interpolate sample viral genome titers.

Total RNA was isolated using a miRNeasy mini kit (Qiagen) and reverse-transcribed into cDNA with the SuperScript III kit (Life Technologies). Real-time reverse transcription–polymerase chain reaction (RT–PCR) was performed with SYBR Green (Applied Biosystems) using a Quant Studio 7 PCR System. Primer sequences are provided in Supplementary Table 2. For miR-34b-3p expression analysis, cDNA was synthesized from total RNA with TaqMan Reverse Transcription kit (Applied Biosystems) with specific primers and the cDNA was subjected to Taqman Probe-based Real Time PCR using and TaqMan miRNA assays Universal PCR Master Mix (Thermo Fisher Scientific) according to the manufacturer's instructions. The expression levels of miRNA were calculated as the amount of target miRNA relative to that of RNU48 control to normalize the initial input of total RNA.

Total RNA was extracted from MGC-803 cell line, and complementary DNA (cDNA) was synthesized using total RNA with the PrimeScript™ RT reagent kit with gDNA Eraser (TaKaRa, Kusatsu, Japan), according to the manufacturer’s instructions. qRT-PCR was performed with AceQ Universal SYBR qPCR Master Mix (Vazyme, Nanjing, China) on an QuantStudio 7 PCR system (Thermo Fisher, Waltham, CA, USA). Primers used in this study were listed as follows: TIRAP (Forward): TCCACCAAAGAGAAAGCAGCC;TIRAP (Reverse): CTTCCTATGTAAGGCCGTAGTG.GAPDH (Forward): GGAGCGAGATCCCTCCAAAAT.GAPDH (Reverse): GGCTGTTGTCATACTTCTCATGG. Relative quantification was determined using the 2^−ΔΔCt method.

Real-time reverse transcription–polymerase chain reaction (RT–PCR) was carried out using a Quant Studio 7 PCR System, TaqMan Universal PCR Master Mix, TaqMan Reverse Transcription kit and TaqMan miRNA assays (Thermo Fisher Scientific) according to the manufacturer’s instructions. The expression levels of miRNA were determined on the amount of target miRNA relative to that of RNU48 as a control to normalize the initial input of total RNA. A QuantiFast SYBR Green PCR Kit was also utilized for gene expression analysis of miR-24 targets. The primers used for SYBR Green-based qPCR analyses are listed in Supplementary Table 1.

Total nucleic acids were extracted from 200 µl of plasma using the MagNA Pure 96 system (Roche, Penzberg, Germany) and eluted in 50 µl. SARS-CoV-2 RNA was detected from 5 µL eluate in a 25 µL reaction mix on a QuantStudio™ 7 PCR system (Thermofisher Scientific, Waltham, MA, USA) in duplicate reactions, according to the method published by Corman et al.^{18 (link)}. SARS-CoV-2 RNA quantitation was calculated using a serial dilution of a synthetic Wuhan coronavirus 2019 E gene RNA control, provided by the European Virus Archive Global (EVAg). The limit of detection (LoD) and limit of quantitation (LoQ) of the assay was 2.29 and 2.70 log₁₀ RNA copies/mL plasma, respectively.