All cell lines were from ATCC (American Type Culture Collection) and were selected to best reflect the respective cancer entities. Hep3B and SNU387 represent hepatocellular carcinoma, the most common form of liver cancer. The pancreatic cancer cell lines were derived from adenocarcinomas, the most common type of pancreatic cancer. Of these, PANC-1 cells represent pancreatic ductal carcinoma, the most common subtype of pancreatic adenocarcinoma. Adenocarcnimoa also is the most common type of gastric cancer, with NCI-N87 and MKN-45 cells representing well differentiated Lauren intestinal-type gastric adenocarcinoma and poorly differentiated Lauren diffuse-type gastric adenocarcinoma, respectively. Cells were tested routinely for mycoplasma contamination every three months. Authenticity was determined on a regular basis by validating the respective immunophenotype described by the provider using flow cytometry. Peripheral Blood Mononuclear cells (PBMC) of healthy donors were isolated by density gradient centrifugation (Biocoll; Biochrom, Berlin, Germany), and monocytes within the PBMC were depleted for coculture experiments using human CD14 MicroBeads UltraPure kit (Miltenyi Biotec, Bergisch Gladbach, Germany). Where indicated, T cells within PBMC were isolated by using either Pan T cell Isolation Kit, human CD4 Micro Beads or human CD8 Micro Beads (Miltenyi Biotec).
Human cd8 microbeads
Manufactured by Miltenyi Biotec
Sourced in Germany
Human CD8 microbeads are a laboratory product designed for the magnetic isolation of CD8+ T cells from human samples. The microbeads are coated with antibodies that specifically target the CD8 surface antigen, allowing for the separation and enrichment of CD8+ cells from complex cell mixtures.
Automatically generated - may contain errors
Lab products found in correlation
Human cd4 microbeads, by Miltenyi Biotec (4 mentions)
Pan t cell isolation kit, by Miltenyi Biotec (3 mentions)
Carboxyfluorescein succinimidyl ester (cfse), by Thermo Fisher Scientific (3 mentions)
Il 15, by Thermo Fisher Scientific (3 mentions)
Ls column, by Miltenyi Biotec (2 mentions)
Facscanto 2, by BD (2 mentions)
Cd8 apc, by BD (2 mentions)
Individual synthetic peptide, by Genemed Synthesis (2 mentions)
Relevant pentamer, by ProImmune (2 mentions)
Aquavivid, by Thermo Fisher Scientific (2 mentions)
Penicillin streptomycin, by Merck Group (2 mentions)
Human serum, by Merck Group (2 mentions)
Brilliant violet buffer, by BD (2 mentions)
Human fcr block, by Miltenyi Biotec (2 mentions)
Pm hiv conb, by JPT Peptide Technologies (2 mentions)
Pm pp65 2, by JPT Peptide Technologies (2 mentions)
Pm ceft mhc 2, by JPT Peptide Technologies (2 mentions)
Pm mog, by JPT Peptide Technologies (2 mentions)
Il 2 proleukin, by Novartis (2 mentions)
Biocoll, by Harvard Bioscience (1 mentions)
26 protocols using human cd8 microbeads
1
Cell Line Selection and Characterization
2
Isolation and Stimulation of Primary Human T Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Peripheral blood mononuclear cells were isolated from peripheral blood of healthy donors (n = 1 male, n = 2 female, age 38 ± 7) by density centrifugation. Primary human Pan T cells were then isolated using magnetic beads (Pan T cell isolation kit, #130-096-535, Miltenyi Biotec), followed by CD4 (human CD4 microbeads, #130-045-101, Miltenyi Biotech) or CD8 (human CD8 microbeads, #130-045-201, Miltenyi Biotec) isolation. Defined numbers of cells were stimulated with platebound anti-CD3 and anti-CD28 antibodies (0.75 µg/ml; # 555329, # 555329, BD Biosciences) for 10 min, 1 h or 6 h, or were left unstimulated. Stimulated T cells were collected after 10 min, 30 min, 1 h, 6 h, 12 h, or 24 h stimulation and RNA was isolated for subsequent real time PCR analysis with the following primers: IL17A (fw: CAATCCCCAGTTGATTGGAA; rev: CTCAGCAGCAGTAGCAGTGACA), IFNG (fw: TCAGCCATCACTTGGATGAG; rev: CGAGATGACTTCGAAAAGCTG), IL13 (fw: TGACAGCTGGCATGTACTGTG; rev: GGGTCTTCTCGATGGCACTG), 18 S (fw: GTAACCCGTTGAACCCCATT; rev: CCATCCAATCGGTAGTAGCG).
3
Enrichment of Immune Cell Subsets
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Single-cell suspensions were thawed for each patient and filtered through a 40-μm filter into complete media (described above). Samples were enriched for CD8+, CD4+, and CD45− cells (on ice) using three sequential rounds of positive selection by magnetic bead separation using MicroBeads (Miltenyi) according to the manufacturer’s protocol. Briefly, cells were resuspended in cell enrichment buffer (described above) and counted. Cells were incubated at 4° C for 15 min with Human CD8 MicroBeads, Human CD4 MicroBeads, or Human CD45 MicroBeads (Miltenyi) and then washed with cell enrichment buffer. Samples were passed through the LS column (Miltenyi), and both the positive and negative fractions were collected. To reduce the duration and maximize the cell recovery steps, CD8− fraction was subsequently used for a second round CD4+ enrichment, and the CD4− fraction was used for the subsequent CD45− enrichment. Solutions were kept on ice throughout the duration of the separation.
4
PBMC Stimulation and CD8+ T Cell Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PBMCs from CP-treated patients were cultured in the presence of IL-2 (100U/ml) with a mixture of consensus B Gag (or Nef, Rev, Tat, Env) peptides (800 ng/ml for each) (NIH AIDS Reagent Program), or with individual synthetic peptide (0.5μg/ml) (Genemed Synthesis). CD8+ T cells were purified after six days of incubation by positive selection using human CD8 microbeads (Miltenyi). To monitor CTL proliferation, PBMCs were stained with CFSE (Life Technologies) prior to incubation and with relevant pentamer (Proimmune) after incubation. PBMCs were then stained with CD8-APC (Becton Dickson, BD) and analyzed by flow cytometry using FACS Canto II (BD).
5
Suppression of CD8+ T Cell Proliferation by MSCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Peripheral blood mononuclear cells (PBMC) were isolated out of human whole blood (n = 5) using a Ficoll gradient, and the resulting freshly isolated naive lymphocytes were enriched for CD8+ T cells using human CD8 MicroBeads (Miltenyi, Bergisch-Gladbach, Germany). Naive CD8+ T cells were labeled with Carboxyfluorescein succinimidyl ester (CFSE) (Molecular Probes, Leiden, Netherlands) and then washed with PBS with 1% FBS to remove extracellular CFSE. Four times ten to the fourth hMSCs or oMSCs per 24-well were cultured for 48 h to reach confluency, and then 1 × 106 CD8+ T cells and αCD3/38-coated beads (ThermoFisher Scientific, Karlsruhe, Germany) were added. The proliferation of the CD8+ T cells was flow cytometrically assessed by analyzing the CFSE dilution after 3 days, as described previously [56 (link),57 (link)].
6
Evaluation of HIV-1-Specific CTL Function in Preventing Latent Infection
7
Purification and Characterization of CD8+ T Cells from PDX Tumors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PDX tumors were cut into ~1 mm3 fragments and incubated for 20 min with collagenase type III (Sigma), in RPMI-1640 medium containing 2% FBS (5 ml/g tumor tissue) at 37 °C. The tumor pieces were transferred to a tissue digestion C-tube (Miltenyi Biotec) and further dissociated enzymatically and mechanically on a gentleMACS Dissociator (Miltenyi Biotec) to generate a single-cell suspension. Afterwards, CD8+ T cells were purified with human CD8 Microbeads (Miltenyi Biotec) or Fluorescence Activating Cell Sorter. Purified cells were subjected to flow cytometry, qRT-PCR, immunoblots, or NF-κB activity assay.
8
EGFR T790M/C797S Peptide-Stimulated PBMC
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The PBMC obtained from healthy donors with HLA‐A*02:01 were co–cultured at a density of 2 × 106 cells/well with 10 μg/mL EGFR T790M/C797S mutation‐derived peptides in 45% RPMI 1640 and 45% AIM‐V (Gibco‐BRL) medium supplemented with 10% human AB serum and recombinant human interleukin (IL)‐2 at 37°C for 14 days. Then, CD8+ cells were isolated from the peptide‐stimulated PBMC using human CD8 microbeads (Miltenyi Biotec GmbH).
9
Stimulation and Characterization of PBMCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PBMCs were thawed and washed, and CD8+ T cells were depleted using human CD8 MicroBeads (Miltenyi Biotec, 130-045-201). CD8+ T cell–depleted PBMCs were cultured in 24-well plates at a concentration of 10 × 106 cells/ml in RPMI 1640 supplemented with Hepes, penicillin/streptomycin, and 10% human serum (Sigma-Aldrich). Cells were rested for 3 h and then stimulated with 0.5 µg/ml of HIV-1 consensus B Gag pool, CMV peptide pool, and CEFT peptide pool (PM-HIV-CONB, PM-PP65-2, PM-CEFT-MHC-II, all from JPT Peptide Technologies) for 18 h at 37°C, 5% CO2. A MOG peptide pool (0.5 µg/ml, PM-MOG, JPT Peptide Technologies) served as negative control. SEB-stimulated cells (0.5 µg/ml, Toxin Technology, BT202) served as positive control. Cells were stained for viability with Aquavivid (Life Technologies) at 1/200 in PBS for 20 min, 4°C; incubated with human FcR Block (Miltenyi Biotec, 130-059-901) at 1/70 in PBS-FBS 1% for 10 min, 4°C; and stained with antibodies to surface markers for 30 min, 4°C with Brilliant Violet Buffer (BD Biosciences, 566349) at 1/4 in PBS-FBS 1% (see Table S4 for antibody staining panel).
10
Transwell Viral Outgrowth Assay for HIV-1
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Transwell viral outgrowth assays were performed as previously described [24 (link), 28 (link), 29 (link)]. Briefly, we depleted CD8+ T cells from the PBMCs isolated from HIV-1-infected individuals with human CD8 microbeads (Miltenyi Biotec, Bergisch Gladbach, Germany) and then activated the cells with phorbol 12-myristate 13-acetate (PMA; 500 ng/ml; Sigma-Aldrich, St. Louis, MO, USA) and ionomycin (1 μg/ml; Sigma-Aldrich, St. Louis, MO, USA) in the presence of IL-2 (20 ng/ml; R&D Systems, Minneapolis, MN, USA) for 1 week. To promote virus release from infected cells, we prepared CD4+ T lymphoblasts 2–3 days before adding them to culture assays, rendering them fully tolerant to viral infection at the time of addition. The CD4+ T lymphoblasts from healthy donors were activated with phytohemagglutinin (PHA; 5 μg/ml; Sigma-Aldrich, St. Louis, MO, USA) and IL-2 (20 ng/ml) and then cocultured with patient cells for 3 days (for PCR assays) or 14 days (for enzyme-linked immunosorbent assays (ELISAs)). The two populations of cells were separated by a cell-impermeable polyester membrane with 0.4 μm pores (Costar™, Corning™, Corning, NY, USA).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!