Bigdye terminator v3.1 cycle sequencing

Fifteen µL of PCR products were cleaned with the PCR DNA fragments extraction kit, (Geneaid, Biotech Ltd.) as per manufacturer's instructions. Direct PCR sequencing was performed using 5 pmol primer (PknbpxaF11 5'-TAAGCGAATCGAATAAGCAGCAG-3 for the Pknbpxa fragment and XB2318F 5'-GGTGTTCATGAAGATGTGCG-3' for the Pknbpxb fragment) with 2 µL BigDye Terminator v3.1 Cycle Sequencing (Applied Biosystems, Life Technologies). Between 34–36 ng of PCR template was included in 10 uL final volume reactions under the following conditions: 96°C 20 sec, 50°C 15 sec 60°C 4 min for 35 cycles. The reactions were Ethanol/Na acetate precipitated before sending to 1st BASE Pte Ltd (Malaysia) for sequencing as above. Only sequences with unambiguous base calls were included see table S2 which summarises PCR reactions and gives the number repeated, the number excluded and why. Sequences with two calls at particular sites, indicative of mixed genotype infections, were among those excluded.

Leishmania detection was performed in captured sandflies and human patients. The latter was made from biopsies collected at the city health service (2020–2021). Polymerase chain reaction (PCR) targeted ITS1 gene before digestion with HaeIII.¹⁹ (link) Phlebotomine were tested with a minimum of one sandfly female specimen or pooled to a maximum of 10 female specimens of the same species, date and place of collection. Negative control groups used male sandflies. Positive controls with 20 nanograms of DNA extracted from reference strains of L. amazonensis (IFLA/BR/67/PH8), L. braziliensis (MHOM/BR/75/M2903), L. infantum (MHOM/BR/74/PP75), L. guyanensis (MHOM/BR/75/M4147), and L. major (MHOM/IL/81/Friedlin), were used. Positive samples were submitted to digestion by HaeIII to identify Leishmania species.²⁰ (link) Amplified PCR products were sequenced. Reactions were performed using BigDye Terminator v.3.1 Cycle Sequencing (Applied Biosystems, Foster City, CA) following the manufacturer’s specifications and assayed in the Sanger ABI 3730 Sequencing. Consensus sequences were obtained and edited using the software package Phred/Phrap/Consed version: 0.020425.c (University of Washington, Seattle, WA). The sequences were evaluated against NCBI database using BLASTn.²¹ (link)

Genomic DNA was extracted from the peripheral blood of the patient using the FlexiGene DNA Kit (Qiagen, Hilden, Germany). Direct Sanger sequencing was performed using the Big Dye Terminator V3.1 Cycle Sequencing, on the ABI 3730XL sequencer (Applied Biosystems, Foster City, CA, USA). Sequencing data were analyzed by SeqScape 2.0 software (Applied Biosystems).

The nucleotide base sequence of the alr was found using a DNA auto‐sequencer (ABI 3130; Applied Biosystems) with a kit (big Dye Terminator v 3.1 Cycle Sequencing; Applied Biosystems) according to the manufacturer's recommended protocols.

The PRDM9 zinc finger array was amplified by PCR in genomic DNA isolated from peripheral blood samples in EDTA. PCR was performed using PN0.6 F and PN2.5 R primers (PN0.6 F: TGAGGTTACCTAGTCTGGCA, PN2.5 R: ATAAGGGGTCAGCAGACTTC)33 (link), 3% DMSO and BioTaq (Bioline). Amplifications were performed as follows: 95 °C for 3 min; 45 cycles of 95 °C for 30 s, 62 °C for 30 s and 72 °C for 105 s. PCR products were purified with PCR DNA purification kit (Thermo Scientific) and subjected to bidirectional Sanger sequencing with the primers PN1.2 F and PN2.4 R (PN1.2 F: TGAATCCAGGGAACACAGGC and PN2.4 R: GCAAGTGTGTGGTGACCACA)33 (link) using BigDye Terminator v3.1 Cycle Sequencing (Applied Biosystems) on a ABI 3130XL Genetic Analyzer (Applied Biosystems).
In order to determine which PRDM9 alleles presented each subject, the zinc finger array sequences were aligned and compared to published data31 (link)33 (link)46 (link)59 (link).

We performed candidate SNP genotyping using TaqMan^® Genotyping Assay kit on ABI 7500 Real-Time PCR System from Applied Biosystems (Foster City, CA, USA). Each polymerase chain reaction sample was composed of 10 ng of DNA, 5× FIREPol^® Master Mix (Solis BioDyne, Estonia), and 1 µL of 20× TaqMan^® SNP Genotyping Assay. We set the thermal cycling conditions at 60 °C for 1 min and at 95 °C for 15 min followed by 40 cycles of 95 °C for 15 s and 60 °C for 1 min. We performed Sanger sequencing, using the BigDye™ Terminator v.3.1 Cycle Sequencing on an Applied Biosystems 3730 xl DNA Analyzer, for selected cases of homozygotes and heterozygotes to validate genotypes determined by the above techniques.

PCR products of mecA gene of two multidrug-resistant MRSA isolates were purified using the QIAquick purification Kit (Qiagen, Germany) and direct cycle sequencing was performed on ABI 3500 Genetic Analyser (Applied Biosystems, USA) using Bigdye Terminator V3.1 cycle sequencing kit. The first software used in analysis of the sequencing result is DNA sequencing analysis software Version 5.1 for viewing and editing the sequence and the second one is SecScape V2.5 used for assembly of the all sequence reactions of the same sample and alignment.