The largest database of trusted experimental protocols

Gibson assembly reaction master mix

Manufactured by New England Biolabs

The Gibson Assembly Reaction Master Mix is a pre-formulated reagent designed for seamless DNA assembly. It contains the necessary enzymes and buffers to efficiently join DNA fragments with overlapping ends through a single-tube isothermal reaction.

Automatically generated - may contain errors

5 protocols using gibson assembly reaction master mix

1

Cloning Populus alba gene into pBBR1MCS3-pBAD

Check if the same lab product or an alternative is used in the 5 most similar protocols

Example 3

The protein sequence for the Populus alba was obtained from GenBank and the full gene, codon optimized for E. coli was purchased from Eurofins MWG. This DNA was used as a template for amplification of the gene using primers 1 and 2 (see Table 1) and Phusion polymerase (NEB) with an annealing temperature of 45° C. The vector backbone of pBBR1MCS3-pBAD was generated with primer 3 and 4 (see Table 1) and with Merck Millipore KOD polymerase with annealing temperatures of 50-55° C. The two fragments were ligated using NEB Gibson Assembly reaction master mix as per the manufacturer's recommended protocol. The ligation mix was transformed into chemically competent E. coli NEB5α and correct clones verified via a combination of colony PCR and sequencing with primers 5 and 6 (see Table 1). Subsequently the whole construct was sequenced by MWG-Eurofins using primers 7-16 (see Table 1). A single verified construct was taken forward for further work and designated pBBR1-ISPS.

+ Open protocol
+ Expand
2

CRISPR DDR Sub-Library Design and Cloning

Check if the same lab product or an alternative is used in the 5 most similar protocols
We designed a CRISPR DDR sub-library containing 4530 sgRNAs targeting 365 genes with a known or suspected DDR or DNA repair function, 45 core-essential genes, and 50 nonessential genes. We included 275 DDR genes described in the Knijnenburg paper [23 (link)], expanded the gene list based on the Pearl paper [5 (link)], and incorporated additional genes from other experts on core DDR pathways. We also included 45 out of 684 CEGv2 (i.e. core-essential) genes and 50 out of 927 NEGv1 (i.e. nonessential) genes as controls described in the Hart paper [16 (link)]. If possible, 10 sgRNAs were designed for each gene. Each oligo (77 nt) contained 20 nt sgRNA, 5’ universal flanking sequence: CTTGTGGAAAGGACGAAACACCG and 3’ flanking sequence: GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGG.
The oligo library was synthesized by Custom Array Inc. (Bothell, WA). The sequences of sgRNAs are provided in Supplementary Table S1. The DDR sub-library was amplified and cloned into lentiCRISPRv2 plasmid using Gibson Assembly Reaction Master Mix (NEB, E2611S).
+ Open protocol
+ Expand
3

Cloning and Characterization of Populus alba Enzyme

Check if the same lab product or an alternative is used in the 5 most similar protocols

Example 2

The protein sequence for the Populus alba was obtained from GenBank (BAD98243.1) and the full gene (with an additional promoter and terminator), codon optimized for E. coli was purchased from Eurofins MWG (SEQ ID NO:52). This DNA was used as a template for amplification of the gene using primers 1 and 2 (see Table 1) and Phusion polymerase (NEB) with an annealing temperature of 45° C. (the open reading frame (ORF) generated lacked the native plasmid tag; this ORF corresponds to nucleotides 168-1865 of SEQ ID NO:52). The vector backbone of pBBR1MCS3-pBAD was generated with primer 3 and 4 (see Table 1) and with Merck Millipore KOD polymerase with annealing temperatures of 50-55° C. The two fragments were ligated using NEB Gibson Assembly reaction master mix as per the manufacturer's recommended protocol. The ligation mix was transformed into chemically competent E. coli NEB5α and correct clones verified via a combination of colony PCR and sequencing with primers 5 and 6 (see Table 1). Subsequently the whole construct was sequenced by MWG-Eurofins using primers 7-16 (see Table 1). A single verified construct was taken forward for further work and designated pBBR1-ISPS (see FIG. 2A; SEQ ID NO:15)

+ Open protocol
+ Expand
4

Amplification and Cloning of Oligo Library into Lentiviral Vector

Check if the same lab product or an alternative is used in the 5 most similar protocols
The oligo library was amplified using the following primer pair GGCTTTATATATCTTGTGGAA AGGACGAAACACCG (forward) and CTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC (reverse) using Phusion High-Fidelity PCR Master Mix (NEB, #M0531S) with four replicates, followed by purification (Qiagen, #28706). The purified product was cloned into the lentiviral sgRNA expression plasmid LentiGuide-Blast using Gibson Assembly Reaction Master Mix (NEB, #E2611S) as previously described with minor modifications (36 (link)). Briefly, Gibson ligation reaction was performed using 50 ng of the purified PCR product of oligo library and 450 ng BsmBI-digested LentiGuide-Blast with two replicates. Electrocompetent cells (25 μl, Lucigen, #60242) were transformed with 2 μl of the ligation product according to the manufacturer’s protocol using a GenePulser (BioRad) and plated onto 15 cm plates with carbenicillin selection (50 μg/ml). To ensure no loss of representation, eight parallel transformations were performed, which should yield 200× library coverage. Colonies were scraped off plates, combined and used for plasmid DNA extraction with Endotoxin-Free Plasmid Maxiprep (Qiagen, #12362). LentiGuide-Blast plasmid was generated by swapping Blasticidin gene into lentiGuide-Puro (Addgene, #52963).
+ Open protocol
+ Expand
5

Comprehensive CRISPR Cell Surface Library

Check if the same lab product or an alternative is used in the 5 most similar protocols
We designed a CRISPR library containing 4,993 sgRNAs targeting 1,157 previously reported cell surface genes (13 (link)), 49 core essential genes, and 49 nonessential genes. Each oligo (77 nt) contained 20 nt sgRNA, a 5′ universal flanking sequence (CTTGTGGAAAGGACGAAACACCG), and a 3′ flanking sequence (GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGG). The oligo library was synthesized by CustomArray Inc. The sequences of the sgRNAs are provided in Dataset S1. The McspKO library was amplified and cloned into lentiCRISPRv2 plasmids using Gibson Assembly Reaction Master Mix (NEB, E2611S).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!