Total RNA was extracted from BV2 microglial cells or ipsilateral brain hemispheres using RNAiso plus (Takara, Kusatsu, Japan). For brain sampling, mice were perfused with autoclaved PBS and their brains were removed. Total RNA (1 µg) was used to generate cDNA by reverse transcription using All-in-One First-Strand cDNA Synthesis SuperMix (TransGen Biotech, Haidian, China). Then mRNA expression levels of M1 and M2 polarization markers were determined using StepOnePlusTM qRT-PCR system (Applied Biosystems, Foster city, CA, USA) with FG Power SYBR Green PCR master mix (Life Technologies, Carlsbad, CA, USA) and specific primer sets (Supplementary Table 1 ). Expression levels of target genes were quantified using the 2−ΔΔCT method relative to β-actin.
Steponeplus qrt pcr system
Manufactured by Thermo Fisher Scientific
Sourced in United States
The StepOnePlus qRT-PCR system is a real-time PCR instrument designed for gene expression analysis, genotyping, and other quantitative PCR applications. The system provides accurate and reliable data with a user-friendly software interface.
Automatically generated - may contain errors
Lab products found in correlation
Rnaiso plus, by Takara Bio (5 mentions)
All in one first strand cdna synthesis supermix, by Transgene (4 mentions)
Sybr green master mix, by Thermo Fisher Scientific (4 mentions)
Power sybr green pcr master mix, by Thermo Fisher Scientific (3 mentions)
Fg power sybr green pcr master mix, by Thermo Fisher Scientific (3 mentions)
Tri reagent, by Merck Group (3 mentions)
Rneasy mini kit, by Qiagen (3 mentions)
Nandrop 2000, by Thermo Fisher Scientific (2 mentions)
Taqman fast one step qpcr master mix, by Thermo Fisher Scientific (2 mentions)
Taqman probes for genes of interest, by Thermo Fisher Scientific (2 mentions)
House keeping gene probes, by Thermo Fisher Scientific (2 mentions)
Trizol reagent, by Thermo Fisher Scientific (2 mentions)
Minibest universal rna extraction kit, by Takara Bio (2 mentions)
Tb green premix ex taq kit, by Takara Bio (2 mentions)
Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (2 mentions)
Power sybr master mix, by Thermo Fisher Scientific (2 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (2 mentions)
Rneasy micro kit, by Qiagen (2 mentions)
Nanodrop 2000c, by Thermo Fisher Scientific (2 mentions)
Simpliamp thermal cycler, by Thermo Fisher Scientific (1 mentions)
31 protocols using steponeplus qrt pcr system
1
Analyzing M1 and M2 Microglial Polarization
2
Brain Hemisphere Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the ipsilateral brain hemisphere using RNAiso Plus (Takara, Kusatsu, Japan). Total RNA (1 µg) was then used to synthesize cDNA with All-in-One First-Strand cDNA Synthesis SuperMix (TransGen Biotech, Haidian, China). qRT-PCR was carried out using a StepOnePlusTM qRT-PCR system (Applied Biosystems, Foster City, CA, USA) with Power SYBR Green PCR master mix (Life Technologies, Carlsbad, CA, USA) and corresponding primers (Table 1 ). The mRNA expression levels of target genes were quantified using the 2−ΔΔCT method and normalized to β-actin.
3
Quantifying LPA Receptor and Cytokine Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Skin tissues were homogenized to extract total RNA using RNAiso plus (Takara, Kusatsu, Japan). StepOnePlusTM qRT-PCR system (Applied Biosystems, Foster City, CA, USA) and FG Power SYBR Green PCR master mix (Life Technologies, Carlsbad, CA, USA) were used for qRT-PCR analysis. Expression levels of each LPA receptor were quantified using the 2−ΔΔCT method relative to 18S. To determine expression levels of pro-inflammatory cytokines (IL-1β, IL-17, and IL-23), semi-quantitative PCR was performed on a SimpliAmp Thermal cycler (Applied Biosystems) with AccuPower® Taq polymerase (Bioneer, Daejeon, Korea). Image J software (National Institute of Mental Health, Bethesda, MD, USA) was used to quantify specific PCR products. The following primer sets were used: LPA1 For: GCAGCACACATCCAGCAATA Rev: GTTCTGGACCCAGGAGGAAT, LPA2 For: TCAGCCTAGTCAAGACGGTTG Rev: CATCTCGGCAGGAATATACCAC, LPA3 For: ACACCAGTGGCTCCATCAG Rev: GTTCATGACGGAGTTGAGCAG, LPA4 For: AGGCATGAGCACATTCTCTC Rev: CAACCTGGGTCTGAGACTTG, LPA5 For: AGGAAGAGCAACCGATCACAG Rev: ACCACCATATGCAAACGATGTG, LPA6 For: TGTGAGATGGGCTGTCTCTG Rev: ACTGGGTTGAAGCCTTCCTT, IL-1β For: GCCTTGGGCCTCAAAGGAAAGAATC Rev: GGAAGACACAGATTCCATGGTGAAG, IL-17 For: GCTCCAGAAGGCCCTCAGACT Rev: CCAGCTTTCCCTCCGCATTGA, IL-23 For: CCCACAAGGACTCAAGGACAA Rev: AGTAGGGAGGTGTGAAGTTGC, and 18S For: CCATCCAATCGGTAGTAGCG Rev: GTAACCCGTTGAACCCCATT.
4
Quantitative Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from either the ipsilateral brain at one and three days after tMCAO challenge or BV2 cells using RNAiso plus (Takara, Kusatsu, Japan). For qRT-PCR, 1 µg of total RNA was reversely transcribed to synthesize cDNA using All-in-One First-Strand cDNA Synthesis SuperMix (TransGen Biotech, Haidian, China). qRT-PCR was performed using the StepOnePlusTM qRT-PCR system (Applied Biosystems, Foster City, CA, USA) with Power SYBR Green PCR master mix (Life Technologies, Carlsbad, CA, USA) and corresponding primers (primer sequences are listed in Table 1 ). The expression levels of the mRNAs were quantified using the 2−ΔΔCT method and then normalized to β-actin.
5
Quantifying RAGE Expression in Stroke
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the ipsilateral brain at 3 days after tMCAO challenge using RNAiso plus (1 mL, Takara, Kusatsu, Japan). For qRT-PCR, 1 µg of total RNA was used to synthesize cDNA using All-in-One First-Strand cDNA Synthesis SuperMix (TransGen Biotech, Haidian, China). qRT-PCR was carried out using a StepOnePlusTM qRT-PCR system (Applied Biosystems, Foster City, CA, USA) with Power SYBR Green PCR master mix (Life Technologies, Carlsbad, CA, USA) and primer sets for β-actin and RAGE. Target mRNA expression levels were then normalized with mouse β-actin and quantified using the 2−ΔΔCT method. Sequences of primers used in this study were as follows: β-actin forward, 5′-AGCCTTCCTTCTTGGGTATG-3′; β-actin reverse, 5′-CTTCTGCATCCTGTCAGCAA-3′; RAGE forward, 5′-ACGAGGATGAGGGCACCTATA-3′; and RAGE reverse, 5′-GTCGTTTTCGCCACAGGATAG-3′.
6
Gene Expression Profiling After tMCAO
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from ipsilateral brain hemisphere at 1 and 3 days after tMCAO challenge using TRI reagent (Sigma-Aldrich). For qRT-PCR, RNA (1 μg) was reverse-transcribed in a reaction mixture containing 3 mM MgCl2, 1 U RNase inhibitor, 0.5 mM dNTP, 1x RT buffer, 500 ng of random primers, and 10 U reverse transcriptase (Agilent, Santa Clara, CA, USA). The synthesized cDNA was used as a template for qRT-PCR using StepOnePlusTM qRT-PCR system (Applied Biosystems, Foster City, CA, USA) and gene-specific primers (Supplementary Table 1 ).
7
Gene Expression Analysis of Kidney Organoids
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA extraction from kidney organoids following drug exposure was performed using an RNeasy Mini kit (Qiagen, Germany) per manufacturer’s instructions. RNA was quantified with spectrophotometry with a NanDrop 2000 (Thermo Fisher, Carlsbad, CA). To analyse gene expression, TaqMan Fast One-Step qPCR Master Mix (Applied Biosystems, Foster City, CA), TaqMan Probes for genes of interest (ThermoFisher, Carlsbad, CA), and house-keeping gene probes (Applied Biosystems, Foster City, CA) were combined in assigned wells with RNA. All qPCR reactions were performed and analysed on a StepOnePlus qRT-PCR system (Applied Biosystems, Foster City, CA). All data was normalized to house-keeping gene GAPDH prior to normalizing to control samples.
8
Quantifying FZD8 Gene Expression in Renal Cancer
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The culture medium was removed, cells were washed with PBS, and total RNA was extracted from renal cancer cell lines and tissues using TRIzol reagent (TaKaRa, Japan) following the manufacturer instructions. RNA concentration was measured at 260 nm in a UV/VIS spectrophotometer from Thermo. Extracted RNA was stored at -80°C. Gene expression was determined using SYBR®Green PCR Kit (Takara, Japan) based on Applied Biosystems StepOne-Plus qRT-PCR System. All mRNAs were normalized to the housekeeping gene β-actin, which was amplified as the internal control. Relative quantification expression was calculated according to the comparative method of 2-ΔΔCT. Primers were purchased from Sangon Corp. Primer sequences used for human FZD8 were:5’-GGACTACAACCGCACCGACCT-3’(forward)and 5’-ACCACAGGCCGATCCAGAAGAC-3’(reverse). PCR condition: 95°C for 10min, 95°C for 15S and 60°C for 1min for 40 cycles, followed by a final extension at 95°C for 15S, 60°C for 1 min and 95°C for 15S. Samples were tested in triplicate runs.
9
Microglia Polarization Profiling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the ipsilateral hemisphere of mice brain and cultured microglia cells using TRIzol Reagent (Invitrogen). One microgram of total RNA was reverse transcribed (RT) to synthesize cDNA. The gene expression levels of the different markers of M1- and M2-polarized microglia were determined using the StepOnePlus™ qRT-PCR system (Applied Biosystems) with the FG Power SYBR Green PCR master mix (Life Technologies) and primer sets (Additional file 1 : Table S1). β-actin was used as the housekeeping gene.
10
qRT-PCR Analysis of circRNA and miRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The Trizol reagent (Invitrogen, USA) was utilized for the extraction of total RNA from the cell culture, followed by synthesis of first strand cDNA with the first-stand cDNA synthesis Kit (Thermoscript, USA). For miRNA analysis, the cDNA synthesis was conducted using Mir-X miRNA first-strand synthesis kit (Takara, Otsu, Japan) following the manufacturer’s protocol. The resulted cDNA was then analyzed using the step-one plus qRT-PCR System (ABI Prizm, Applied Biosystems, USA) on the QuantStudio PCR system (BioRad, USA). For the analysis of relative gene expression, the 2−△△Ct method was employed, with GAPDH as the internal reference for circSOD2/PRDX3 and U6 snRNA as the internal reference for the miRNA. The following primer sequences (Sangon Biotech, Shanghai) were used in qRT-PCR analysis: circSOD2 forward: 5′-AAACCACGATCGTTATGCTG-3′ and reverse: 5′-CGTTAGGGCTGAGGTTTGTC-3′; hsa-miR-224-5p forward: 5′-CAAGTCACTAGTGGTTCCGT TTAG-3′ and reverse: 5′-CTCAACTGGTGTCGTGGAGTC-3′; PRDX3 forward: 5′-TCGCAGTC TCAGTGGATTCC-3′ and reverse: 5′-ACAGCACACCGTAGTCTCGG-3′; hsa-miR-532-3p forward: 5′-ATCCTCCCACACCCAAGG-3′ and reverse: 5′-GTGCAGGGTCCGAGGT-3′; U6: forward, 5′-CTCGCTTCGGCAGCACAT-3′ and reverse 5′-AACGCTTCACGAATTTGCGT-3′; GAPDH: forward: 5′-GGTGAAGGTCGGAGTC-3′ and reverse: 5′-GAAGATGGTGATGGGATTTC-3′.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!