Mircute plus mirna qpcr detection kit sybr green

The expression of miRNAs was confirmed using the stem-loop qRT-PCR method. Total RNA was extracted by TRIzol (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s recommendation (Invitrogen, USA) and then reverse-transcribed into cDNA using a Reverse Transcriptase M-MLV (TaKaRa) and Hairpin-itTM microRNA qPCR Quantitation Kit (GenePharma, Shanghai, China). qPCR was performed using a SYBR^® Select Master Mix kit and standard protocols on a Step One Plus Real-Time PCR System (Applied Biosystems, USA). For let-7 miRNAs and RNA sequencing data validation, the Poly(A) Plus real-time PCR method was used. Total RNA was isolated and reverse-transcribed into cDNA by a themiRcute Plus miRNA First-Strand cDNA Synthesis Kit (#KR211-02, Tiangen Biotech Co., Ltd, Beijing, China) and subsequently determined using a miRcute Plus miRNA qPCR Detection Kit (SYBR Green) (#FP411-02, Tiangen Biotech Co., Ltd, Beijing, China) according to the manufacturer’s recommendation. U6 small nuclear RNA was used as an internal control for miRNAs, and mRNA levels were normalized to glyceraldehyde 3-phosphate dehydrogenase (GAPDH). The 2^−ΔΔCt comparative method was used to analyze the expression levels. The mRNA, miRNA and U6 primers are listed in Supplemental Table 1.

Total RNAs from the myocytes (n = 3) were isolated by using the RNAiso Plus kit (TaKaRa). RNA quantification was detected on Infinite1 200 PRO NanoQuant spectrophotometer. The cDNAs for mRNAs were reversely transcribed by using the Prime-Script^TM RT reagent Kit with gDNA Eraser (TaKaRa) and for miRNAs were synthesized by using the miRcute Plus miRNA First-Strand cDNA Synthesis Kit (TIANGEN, Beijing, China). Quantitative RT-PCR was performed in triplicate wells with the 7500 Real Time PCR System (Applied Biosystems, Shanghai, China). TB Green^TM Premix Ex Taq^TM II (Tli RNaseH Plus, TaKaRa) was used for protein-coding gene analysis and the miRcute Plus miRNA qPCR Detection Kit (SYBR Green, TIANGEN) was used for miRNA analysis. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and U6 served as internal control for protein-cording genes and miRNAs respectively. Sequence information for the primers used in this study is provided in Table S3.

Total RNAs were extracted from 30 NPC serum specimens by using miRcute miRNA Isolation Kit (No. DP503, TIANGEN Biotech, Beijing, China), and were reversely transcribed into cDNA by miRcute Plus miRNA First-Strand cDNA Synthesis Kit (No. KR211, TIANGEN Biotech, Beijing, China) according to manufacter’s protocol. During this procedure, the 3′ terminal of miRNAs was polyadenylated and converted into cDNA by reverse transcriptase using oligo-dT and universal primers. The forward primers of miRNAs were ordered from Sangon Biotech (Shanghai) Co Ltd and TIANGEN Biotech for qPCR and all forward primer sequences were shown in Table 1. qPCR was performed to validate expression level of selected miRNAs by usage of miRcute Plus miRNA qPCR Detection Kit (SYBR Green) (No. FP411, TIANGEN Biotech, Beijing, China). We selected hsa-U6 as the internal control. All experiments were carried out in triplicate following the manufacturer’s instructions^{17 (link)}.Table 1

Specific forward primers for candidate miRNAs.

miRNA	Forward Primers	Corporation
hsa-miR-1281	TCGCCTCCTCCTCTCCC	Sangon Biotech
hsa-miR-6732-3p	TAACCCTGTCCTCTCCCTCC	Sangon Biotech
hsa-miR-6865-3p	ACACCCTCTTTCCCTACCG	Sangon Biotech
hsa-miR-1825	No. CD201-0078	TIANGEN Biotech

For miRNAs, total RNA was reverse-transcribed into cDNA by the miRcute Plus miRNA First-Strand cDNA Synthesis Kit (#KR211-02, Tiangen Biotech) and subsequently determined using a miRcute Plus miRNA qPCR Detection Kit (SYBR Green) (#FP411-02, Tiangen Biotech) with Qiagen predesigned primers. All kits were used according to the manufacturer’s instructions. A U6 transcript was used as an internal control to normalize RNA input. For lncRNA, total RNA was reverse-transcribed into cDNA by the ReverTra Ace^® (#TRT-101, TOYOBO) with random primers and subsequently determined using a FastStart Universal SYBR Green Master Kit (#4913914001, Roche) with specific lncRNA primers. All kits were used according to the manufacturer’s instructions. lncRNA levels were normalized to glyceraldehyde 3-phosphate dehydrogenase (GAPDH). Human MALAT1 (hMALAT1) primer: hMALAT1 (forward): 5′-ctaggactgaggagcaagcg-3′; hMALAT1 (reverse): 5′-accaaatcgttagcgctcct-3′.

Total RNA from the adipocytes (n = 3) was isolated using the RNAiso Plus kit (Takara Biomedical Technology Co., Ltd., Beijing, China) according to the manufacturer’s instructions. RNA was then reversely transcribed into cDNA using the Prime-Script™ RT reagent Kit with gDNA Eraser (Takara Biomedical Technology Co., Ltd.) for mRNA or the miRcute Plus miRNA First-Strand cDNA Synthesis Kit (TIANGEN, Beijing, China) for miRNA. The cDNA was then used as a template for qRT-PCR in triplicate wells in the 7500 Real Time PCR System (Applied Biosystems, Shanghai, China). TB Green™ Premix Ex Taq™ II (Tli RNaseH Plus, Takara, Beijing, China) was used for protein-coding gene analysis and the miRcute Plus miRNA qPCR Detection Kit (SYBR Green, TIANGEN) was used for miRNA analysis. The mRNA expression level was normalized to that of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and the miRNA expression level was normalized to that of U6. Three repeats of the qRT-PCR assays were performed. The experimental data were analyzed using the 2^−ΔΔCt method [61 (link)]. Sequence information for the primers are provided in Table S4.

SV-HUC-1 and human bladder cancer cell lines T24 and 5637 were purchased from the Chinese Academy of Sciences (Shanghai, China); The 5637 series of bladder cancer is a human origin, which is a situ bladder cancer cell derived from the upper skin, with a moderate degree of malignancy. Bladder cancer T24, derived from human bladder transitional cell carcinoma cells, is an epithelioid metastatic adenocarcinoma with a high degree of malignancy. RPMI-1640 medium and fetal bovine serum were purchased from GIBCO (USA); CCK-8 Cell Proliferation Detection Kit was purchased from KeyGEN Bio TECH (Nanjing, China); 24-well plates with a transwell chamber was purchased from Corning (NY, USA); let-7i mimic, let-7i mimic negative control, HMGA1 primers and let-7i primers were purchased from RiboBio (Guangzhou, China); Trizol Universal reagent, miRcute Plus miRNA First-Strand cDNA Synthesis Kit and miRcute Plus miRNA qPCR Detection Kit (SYBR Green) were purchased from TIANGEN (Beijing, China); RevertAid™ First Strand cDNA Synthesis Kit was purchased from Thermo (Shanghai, China); SYBR®Premix Ex TaqTM(Tli RNaseH Plus) was purchased from TaKaRa (Beijing, China); The rabbit polyclonal antibodies against HMGA1 was purchased from Abcam (Cambridge, UK); The rabbit polyclonal antibodies against β-Actin was purchased from Cell Signaling Technology (Danvers, MA, USA).

Rat hearts were removed and the left atrial tissue was isolated. Total RNA and miRNA were extracted using RNAeasy Mini Kit (Qiagen, Netherlands) and miRcute miRNA isolation kit (TIANGEN Biotech, China) following the manufacturer's instruction, respectively. Quantitative detection of total RNA and miRNA was performed by using a NanoDrop 2000 spectrophotometer (Thermo Scientific, USA). Further detection of miR-27b-3p and Wnt3a levels and RNA reverse transcription to cDNA using miRcute Plus miRNA First-Strand cDNA Synthesis Kit (TIANGEN Biotech, China) and RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific, USA) were performed according to their respective protocols. The primers of miR-27b-3p, Wnt3a, U6, and β-actin were designed and synthesized by TaKaRa (Kyoto, Japan) (Table 1). The RT-PCR assay for miR-27b-3p and Wnt3a was performed with the ABI 7500 Real-Time (RT) PCR System (Applied Biosystems, USA) with miRcute Plus miRNA qPCR Detection Kit (SYBR Green) (TIANGEN, China) and Fast SYBR Green Master Mix Kit (Applied Biosystems, USA) by the manufacturer's instructions, respectively. Fold changes in the miR-27b-3p and Wnt3a level were calculated using 2^-△△Ct methods and U6 or β-actin used as an internal control, respectively.