Plvx tre3g vector

The WTIP coding sequence with a 3×FLAG-tagged sequence was amplified from HEK293 cells, and then cloned into the pLVX-tre3G vector (Clontech, CA, USA) or pCDH-MSCVMCS-EF1α-GFP+Puro (System Biosciences, Palo Alto, CA, USA) using Hieff Clone^TM One Step Cloning Kit (Yeasen, Shanghai, China) as previously described [21 (link)]. The FOXO3a coding sequence with a 3×FLAG-tagged sequence was amplified from HEK293 cells, and cloned into the pCDH-MSCVMCS-EF1α-GFP+Puro (System Biosciences, Palo Alto, CA, USA) using Hieff Clone^TM One Step Cloning Kit as previously described [23 (link)]. The sequence of shRNAs for WTIP was designed (shWTIP target sequence: 5′-CCGGCAGCGTGTGTGGACATCTCATCTCGAGATGAGATGTCCACACACGCTGTTTTTG-3′).

For stable overexpression of SNAI1, plasmid encoding full length wide type SNAI1 cloned from pCMV-Entry-SNAI1 (Origene) into pLenti-GIII-CMV-GFP-2A-Puro vector (ABM). Empty vector with no inserts was used as negative control. Plasmids were mixed with Mission Lentiviral Packaging Mix (Sigma-Aldrich) before added to a mixture of transfection reagent Fugene 6 (Roche). After 15 minutes incubation at room temperature, plasmid mix was added to 293T cells and viral supernatants were harvested at 48 and 72 hours post-transfection. Cells infected with lentivirus were selected using puromycin at a proper concentration decided by their respective puromycin kill curve.
To generate Tet-inducible SNAI1 expressing cells, SNAI1 was cloned from pCMV6-Entry-SNAI1 vector using into pLVX-TRE3G vector (Clontech). pLVX-TRE3G-SNAI1 was cotransfected with pLVX-EF1Alpha-Tet3G (Clontech) to 293T cells to generate lentiviral supernatants. Cells infected with lentivirus were dually selected using puromycin and G418. Same primer pairs containing BamHI and EcoRI were used for generating both vectors and were listed in Supplementary Table S1.

Cloning of UCP1, mitoLbNOX, and LbNOX into pLVX-TRE3G vector
Mouse UCP1 gene and human codon-optimized mitoLbNOX and LbNOX (addgene #74448 and #75285) were cloned into pLVX-TRE3G vector (Clontech, CA) using Gibson assembly. All constructs also included strong Kozak sequence (GCCACCATGGGG) at the upstream of the start codon.

Pancreatic organoids were infected with a two-vector lentivirus-based Tet-on system (Clontech). Coding sequences for HA-tagged WT and 6S-A Ngn3, fused with GFP-2A cleavage peptide sequence at their N-terminus, were cloned into the pLVX-TRE3G vector (Clontech). Viruses were generated in HEK293T cells, titrated with the LentiX titration kit (Clontech) and used at multiplicity of infection of 10 for the transgene, or 20 for the transctivator Tet3G. Organoids were dissociated to small clusters by TrypLE (Gibco) treatment for 10 min at 37⁰C. Dissociated organoids were incubated with the viruses and 8μg/ml polybrene (Sigma) in expansion media supplemented with 10μM ROCKI (Sigma) and spun for 1h at 300xG at room temperature. After spinoculation, infected organoids were incubated in a cell culture incubator at 37⁰C for 5-6 hours before plating in matrigel with fresh media supplemented with ROCKI.

Lenti-X Tet-On 3G-Inducible Expression System (Clontech) was used for GRHL2 overexpression. The complementary DNA (cDNA) of GRHL2 was cloned into pLVX-TRE3G vector (631191, Clontech) using standard molecular cloning techniques. The mutated GRHL2* (resistant to shGRHL2 #12) was generated by introducing four silent point mutations to the wild-type cDNA using QuickChangeII XL Site-Directed Mutagenesis Kit (Agilent). The 293T cells were transfected with pLVX-Tet3G, viral packaging mix, and pLVX-TRE3G-GRHL2 or pLVX-TRE3G-GRHL2* using Lenti-X HTX Packaging Mix 2 System (631260, Clontech). Viruses were harvested to infect IOSE523, HeyA8, and OVCA429 shGRHL2 #12 cells. GRHL2 expression was induced by doxycycline (1 μg/ml for 48 or 96 h). Cells were treated with GSK126 (S7061, Selleck Chemicals) at a final concentration of 5 μM for 72 h; mocetinostat (S1122, Selleck Chemicals) at 1 μM (OVCA429 shGRHL2 Tet-GRHL2*) or 0.5 μM (IOSE523 and HeyA8) for 48 h; 5-azacitidine (S1782, Selleck Chemicals) at 1 μM for 144 h.

pLVX-flag was a gift from Dr. Tao Guo (The First Affiliated Hospital, Dalian Medical University, Dalian, China). pLVX-mVenus-p27K^- was a gift from Dr. Bing Liu (Institute of Cancer Stem Cell, Cancer Center, Dalian Medical University, Dalian, China). VLDLR-I, VLDLR-II, LDLR, and RAP fragments were cloned from human genome cDNA. The primers were as follows: VLDLR-I/II: Forward, 5′-CTACCGGACTCAGATGCCACCATGGGCACGTCCGCGCTCT; Reverse, 5′-TACCCGGTAGAATTATCTAGATCAAGCTAGATCATCATCT. LDLR: Forward, 5′-CCGCGGCCGCGCCACCATGGGGCCCTGGGGCTGGAA; Reverse, 5′-TCCATATGTCACGCCACGTCATCCTCCA. RAP: Forward, 5′-GATCTGGTTCCGCGTGGATCCATGGCGCCGCGGAGGGTCA; Reverse, 5′-GTCACGATGCGGCCGCTCGAGTCAGAGTTCGTTGTGCCGA. DsRed fragment was replaced by the VLDLR-I/II fragment in the pLVX-DsRed-Monomer-N1 vector (Clontech). The LDLR fragment was ligated into the pLVX-TRE3G vector (Clontech). The RAP fragment was recombinated into the pGEX-4T-1 vector (Clontech). The shRNAs specifically targeting VLDLR were cloned into the pLKO-Tet-On-shNC vector. The primers were as follows: shVLDLR-1: Forward, 5′-CCGGGCACAGATGATGATCTAGCTTCTCGAGAAGCTAGATCATCATCTGTGCTTTTTG; Reverse, 5′-AATTCAAAAAGCACAGATGATGATCTAGCTTCTCGAGAAGCTAGATCATCATCTGTGC. shVLDLR-2: Forward, 5′-CCGGGCTTGATTCTAAGTTGCACATCTCGAGATGTGCAACTTAGAATCAAGCTTTTTG; Reverse, 5′-AATTCAAAAAGCTTGATTCTAAGTTGCACATCTCGAGATGTGCAACTTAGAATCAAGC.