Pgl3 basic luciferase vector

Manufactured by Thermo Fisher Scientific

Sourced in United States

The PGL3-basic luciferase vector is a plasmid that contains the firefly luciferase gene. It is commonly used as a reporter gene in various experiments to monitor gene expression or cellular activity.

Automatically generated - may contain errors

Lab products found in correlation

Pgl3 basic luciferase vector, by Promega (2 mentions) Lipofectamine 3000 reagent, by Thermo Fisher Scientific (2 mentions) Lipofectamine 2000, by Thermo Fisher Scientific (1 mentions) Luciferase reporter assay kit, by Promega (1 mentions) Geneart site directed mutagenesis plus kit, by Thermo Fisher Scientific (1 mentions) Dual luciferase reporter assay system, by Promega (1 mentions)

6 protocols using pgl3 basic luciferase vector

Cloning and Characterization of HDAC6 Promoter

Check if the same lab product or an alternative is used in the 5 most similar protocols

We amplified a 2000 bp sequence upstream of the transcription start sites of the HDAC6 promoter by PCR and then cloned it into a pGL3-basic luciferase vector (Invitrogen) to generate pHDAC6/2000-Luc, which was used to generate HDAC6-p1 (− 2000 to − 1 bp), HDAC6-p2 (− 1589 to − 1 bp), HDAC6-p3 (− 1544 to − 1 bp), HDAC6-p4 (− 1432 to − 1 bp) and HDAC6-p5 (− 1333 to − 1 bp). The 3′-UTR reporter plasmids of HDAC6 and HNF4α for miR-1 were constructed using the chemically synthesized DNA oligos: HNF4α-wtUTR and HDAC6-wtUTR containing the full-length cDNA sequence, and HNF4α-mutUTR and HDAC6-mutUTR expression vectors lacking the 3′-UTR were also constructed.

Wang N., Chen M., Ni Z., Li T., Zeng J., Lu G., Wang J., Zhang J., Wu S, & Shi Y. (2020). HDAC6/HNF4α loop mediated by miR-1 promotes bile acids-induced gastric intestinal metaplasia. Gastric Cancer, 24(1), 103-116.

+ Open protocol

+ Expand

PTEN 3'UTR Luciferase Reporter Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols

The luciferase reporter assay experiment was conducted using the pGL3-basic luciferase vector (Promega, Madison, WI, United States). The 3’-UTR sequence of PTEN predicted to interact with miR-1297, together with a corresponding mutated sequence within the predicted target sites, were synthesized and inserted into the luciferase reporter (Promega, Madison, WI, United States) to generate PTEN wild-type or PTEN mutant (primers shown in Supplementary Table 2). The pGL3-basic luciferase vector containing PTEN wild-type or PTEN mutant were cotransfected with miR-1297 mimics or negative control mimics using Lipofectamine2000 (Invitrogen). After transfection, cells were incubated in suitable conditions for 24 h. The luciferase reporter Assay Kit (Promega) was used to assess the relative luciferase activity in accordance with the manufacturer’s instructions. Firefly luciferase values were normalized to those of Renilla luciferase.

Luo X., Luo S.Z., Xu Z.X., Zhou C., Li Z.H., Zhou X.Y, & Xu M.Y. (2021). Lipotoxic hepatocyte-derived exosomal miR-1297 promotes hepatic stellate cell activation through the PTEN signaling pathway in metabolic-associated fatty liver disease. World Journal of Gastroenterology, 27(14), 1419-1434.

+ Open protocol

+ Expand

SNAI2 and miR-1 Promoter Cloning and Luciferase Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols

A specific sequence upstream of the transcription start site of the SNAI2 promoter was amplified by PCR and then cloned it into a pGL3-basic luciferase vector (Invitrogen, USA) to generate SNAI2-p1 (−2000 bp ~ +500 bp), SNAI2-p2 (−543 bp ~ +500 bp), SNAI2-p3 (+398 bp ~ +500 bp) and SNAI2-p4 (+415 bp ~ +500 bp). We also amplified the 2000-bp sequence upstream of the transcription start sites of the miR-1 promoter, and then cloned it into a pGL3-basic luciferase vector.

Wang N., Wu S., Zhao J., Chen M., Zeng J., Lu G., Wang J., Zhang J., Liu J, & Shi Y. (2021). Bile acids increase intestinal marker expression via the FXR/SNAI2/miR-1 axis in the stomach. Cellular Oncology (Dordrecht), 44(5), 1119-1131.

+ Open protocol

+ Expand

Cloning and Analyzing SNAI2 and miR-1 Promoters

Check if the same lab product or an alternative is used in the 5 most similar protocols

We ampli ed a speci c sequence upstream of the transcription start sites of the SNAI2 promoter by PCR, and then cloned it into a pGL3-basic luciferase vector (Invitrogen, USA) to generate SNAI2-p1 (-2000bp~+500bp), SNAI2-p2 (-543bp~+500bp), SNAI2-p3 (+398bp~+500bp) and SNAI2-p4 (+415bp~+500bp). We also ampli ed the 2000 bp sequence upstream of the transcription start sites of the miR-1 promoter, and then cloned it into the pGL3-basic luciferase vector.

Wang S., Chen M., Zeng J., Lu G., Wang J., Zhang J., Wu S., & Shi Y. (2020). Bile acids increase intestinal markers via FXR/SNAI2/miR-1 axis in the stomach.

+ Open protocol

+ Expand

Cloning and Mutating NR_045064 NF-κB Sites

Check if the same lab product or an alternative is used in the 5 most similar protocols

The −1906 to +139 region of the NR_045064 gene, which contains four putative NF-кB binding sites, was cloned into the multiple cloning site of the pGL3-Basic Luciferase vector (Thermo Fisher Scientific). The following primers were used to amplify the sequence: 5’-GGGTACCAGTCAGTTTTACTATG -3’ (forward, with the restriction site for KpnI) and 5’- CCAAGCTTCCACGCAGAAGG -3’ (reverse, with the restriction site for HindIII). The vectors with the mutants of the putative NF-кB binding sites using the GeneArt Site-Directed Mutagenesis PLUS kit (Thermo Fisher Scientific) and the empty vector were used as the control. The sequences for primers used for mutants are listed in Table S1. Cultured cells were transfected with the reporter construct overnight and then exposed to C. parvum infection for 8 h in the presence or absence of SC-514 or JSH-23 followed by assessment of luciferase activity. The luciferase activity was normalized to the control β-galactosidase level and compared with that of the pGL3 basic vector.

Li M., Gong A.Y., Zhang X.T., Wang Y., Mathy N.W., Martins G.A., Strauss-Soukup J.K, & Chen X.M. (2018). Induction of a long non-coding RNA transcript, NR_045064, promotes defense gene transcription and facilitates intestinal epithelial cell responses against Cryptosporidium infection. Journal of immunology (Baltimore, Md. : 1950), 201(12), 3630-3640.

+ Open protocol

+ Expand

Investigating p53 Regulation of miR-628

Check if the same lab product or an alternative is used in the 5 most similar protocols

The wild-type (WT) promoter region for the transcription of pre–miR-628 (2 kb upstream of the pre–miR-628 gene) was cloned into the pGL3 basic luciferase vector (Promega). Then, the mutant-type (MUT) promoter region that lost p53 binding sites was also synthesized and cloned into the pGL3 basic luciferase vector. A dual-luciferase reporter assay was carried out by cotransfecting the pGL3 basic luciferase vector containing the WT or MUT promoter region (see Supplementary Figure S2) of pre–miR-628, p53-expressing plasmid, empty vector control, and Renilla luciferase vector into 293T cells using the Lipofectamine 3000 reagent (Thermo Fisher Scientific). The firefly and Renilla luciferase activity were measured with the dual-luciferase reporter assay system (Promega). Firefly luciferase activity was normalized to Renilla activity and presented as relative luciferase activity. All assays were performed in triplicate three times.

Pan J., Li M., Yu F., Zhu F., Wang L., Ning D., Hou X, & Jiang F. (2021). Up-Regulation of p53/miR-628-3p Pathway, a Novel Mechanism of Shikonin on Inhibiting Proliferation and Inducing Apoptosis of A549 and PC-9 Non–Small Cell Lung Cancer Cell Lines. Frontiers in Pharmacology, 12, 766165.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!