The non‐metastatic HCC Huh7 and metastatic HCC MHCC97L cell lines were used to establish non‐target control (CTL‐KD) and CFH knockdown stable clones (CFH‐KD1 and CFH‐KD2) using MISSION non‐target shRNA control vector and two different shRNA targeting sequences of CFH (Sigma‐Aldrich), sh‐57134 (5′‐CCGGGCCAGTAATGTAACATGCATTCTCGAGAATGCATGTTACATTACTGGCTTTTTG‐3′) and sh‐371774 (5′‐CCGGTACTCACCTTTAAGGATTAAACTCGAGTTTAATCCTTAAAGGTGAGTATTTTTG‐3′), respectively. 293FT cells were co‐transfected with shRNA, Lenti‐Pac HIV mix (GeneCopoeia Inc.) and EndoFectin Lenti transfection reagent (GeneCopoeia Inc.). The viral supernatant was collected and used to transduce HCC cells. The transduced cells were selected by puromycin (Merck). The CFH expression of the resistant clones was examined by western blotting.
Mission non target shrna control vector
Manufactured by Merck Group
Sourced in Japan
The MISSION Non-Target shRNA Control Vector is a lab equipment product designed for use in RNA interference (RNAi) experiments. It serves as a control vector, allowing researchers to assess the effects of shRNA expression without targeting a specific gene of interest.
Automatically generated - may contain errors
Lab products found in correlation
Puromycin, by Merck Group (2 mentions)
Lenti pac hiv mix, by GeneCopoeia (1 mentions)
Endofectin lenti transfection reagent, by GeneCopoeia (1 mentions)
Puromycin, by Thermo Fisher Scientific (1 mentions)
Mission packing mix, by Merck Group (1 mentions)
Fugene hd transfection reagent, by Promega (1 mentions)
Pct cd63 gfp, by System Biosciences (1 mentions)
Psicheck 2 vector, by Promega (1 mentions)
Pgl3 control vector, by Promega (1 mentions)
Trcn0000123176, by Merck Group (1 mentions)
Rsv rev, by Addgene (1 mentions)
Pegfp n3 vector, by Takara Bio (1 mentions)
Lipofectamine 2000 system, by Thermo Fisher Scientific (1 mentions)
Geneticin, by Thermo Fisher Scientific (1 mentions)
7 protocols using mission non target shrna control vector
1
Establishing CFH Knockdown HCC Cells
2
Lentiviral Knockdown of PRKCA and PKN2
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The following double strand oligos (only sense strands indicated) were cloned into the pLKO.1 plasmid at AgeI and EcoRI sites and sequence verified before use. shPRKCA: 5′-CCGGCGAGGTGAAGGACCACAAATTCTCGAGAATTTGTGGTCCTTCACCTCGTTTTTTG-3′, shPKN2: 5′-CCGGGTCCACGTCAAAGTATGATATCTCGAGATATCATACTTTGACGTGGACTTTTTG-3′. A MISSION non-target shRNA control vector served as the scrambled control (Sigma-Aldrich, SH002). Lentivirus were produced by cotransfection of 293T cells with above constructs and the MISSION packing mix (Sigma-Aldrich) using FuGENE HD transfection reagent (Promega). Cells were incubated with lentivirus for 24 hours before selection with puromycin (Gibco). Gene knockdown was confirmed by western blotting analysis.
3
PTHLH and PTH1R Silencing in Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human PTHLH and PTH1R genes were stably silenced using shRNA‐based MISSION technology (Sigma‐Aldrich) (Table S2) with lentiviral particles. HEK293T were transfected with the packaging plasmids (RRE, Rev and VSV‐G), and the correspondent shRNA vector and lentiviral particles were collected from the medium for 2 days. Neuroblastoma and osteosarcoma cells were infected with the produced lentiviruses and selected with puromycin (Sigma‐Aldrich). As a control, a MISSION Non‐Target shRNA control vector (Sigma‐Aldrich) was used.
4
Sensor Vectors for miRNA Detection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
pCT‐CD63‐GFP was purchased from System Biosciences (Mountain View, CA). MISSION Non‐Target shRNA Control Vector and MISSION Luciferase shRNA Control Vector were purchased from Sigma‐Aldrich Japan (Tokyo, Japan). pGL3‐Control Vector was purchased from Promega (Madison, WI). The sensor vector for luc shRNA was constructed by introducing a binding site with perfect complementarity to luc shRNA into XbaI site of psiCHECK‐2 Vector (Promega). The sequences of the binding site are as follows: 5′‐CGCTGAGTACTTCGAAATGTC‐3′ (sense) and 5′‐GACATTTCGAAGTACTCAGCG‐3′ (antisense). Sensor vectors for hsa‐miR‐141‐3p and hsa‐miR‐200b‐3p were constructed by introducing three tandem binding sites with perfect complementarity to each microRNA (miRNA) into XhoI and NotI sites of psiCHECK‐2 Vector. The sequences of the binding sites are as follows: 5′‐CCATCTTTACCAGACAGTGTTA‐3′ (sense) and 5′‐TAACACTGTCTGGTAAAGATGG‐3′ (antisense) for hsa‐miR‐141‐3p, 5′‐TCATCATTACCAGGCAGTATTA‐3′ (sense) and 5′‐TAATACTGCCTGGTAATGATGA‐3′ (antisense) for hsa‐miR‐200b‐3p.
5
Lentivirus-Mediated Knockdown of GLIPR1
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The lentiviruses encoding shRNA sequences against the GLIPR1 gene were obtained from Sigma-Aldrich (SHCLNV-NM_006851). Clones TRCN0000123175 and TRCN0000123176 (Sigma-Aldrich) were used for screening, and clone TRCN0000123176 chosen for subsequent experiments. As negative control, cells were transduced with the MISSION Non-Target shRNA Control Vector (Sigma-Aldrich). After 72 h, infected ALL cell lines REH, RS4;11, Jurkat and TALL-1 were selected with 1.5 μg/mL (RS4;11) or 2.5 μg/mL (REH, Jurkat and TALL-1) puromycin during 10 days. Bulk cells, cultured 1 week without puromycin, were used for experiments.
6
Knockdown of PLVAP Expression in In Vitro BRB Models
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For knockdown of PLVAP expression, shRNA lentiviral pLKO.1 constructs (SIGMA/TRC; Sigma-Aldrich, Zwijndrecht, the Netherlands) were used. Control cells were transduced with nontargeting shRNA (MISSION Non-Target shRNA Control Vector; Sigma-Aldrich). Virus particles were generated by co-transfecting the constructs with three packaging plasmids, pMDLg/pRRE, pMD2G, and RSV-Rev (Addgene, Cambridge, MA), into 293T cells. The sequences of PLVAP shRNA and Non-Target shRNA were 5 0 -CC-GGCCCTTTCACACACACTTTCTACTCGAGTAGAAAG-TGTGTGTGAAAGGGTTTTTTG-3 0 and 5 0 -CCGGCAACA-AGATGAAGAGCACCAACTCGAGTTGGTGCTCTTC-ATCTTGTTGTTTTT-3 0 , respectively.
In Vitro BRB Model Cells were isolated as described previously. 6 Three different models were assembled to study endothelial barrier permeability, including i) a bovine retinal endothelial cell (BREC) monolayer, ii) a triple co-culture model with BRECs, pericytes, and astrocytes, and iii) human umbilical vein endothelial cells (HUVECs). In the triple co-culture model, BRECs were seeded on top of the Transwell filter, primary rat astrocytes were seeded on the reverse side of the Transwell filters, and bovine primary pericytes were cultured on the bottom of a 24-well plate in which a Transwell filter was placed, as described previously. 6 Three independent experiments were performed for each model (n ! 11).
In Vitro BRB Model Cells were isolated as described previously. 6 Three different models were assembled to study endothelial barrier permeability, including i) a bovine retinal endothelial cell (BREC) monolayer, ii) a triple co-culture model with BRECs, pericytes, and astrocytes, and iii) human umbilical vein endothelial cells (HUVECs). In the triple co-culture model, BRECs were seeded on top of the Transwell filter, primary rat astrocytes were seeded on the reverse side of the Transwell filters, and bovine primary pericytes were cultured on the bottom of a 24-well plate in which a Transwell filter was placed, as described previously. 6 Three independent experiments were performed for each model (n ! 11).
7
Knockdown of Human EB1 Gene
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ShRNA plasmid that specifically knocked out human EB1 (NM_012325) and negative shRNA control plasmid (Mission non-target shRNA control vector) were obtained from Sigma-Aldrich. Cells were transfected according to the protocol previously described (21) . Stable GFP-shRNA-transfected cells were obtained after transfection with peGFP-N3 vector (Clontech) using lipofectamineTM 2000 system (Invitrogen) and selection with 0.6 mg/mL geneticin (Life Technologies).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!