Egfp rab5

Wild-type HeLa cells were transfected with pEGFPC1-human APPL1, a gift from Pietro De Camilli (Addgene plasmid #22198)^{6 (link)}; EEA1 TagRFP-T, a gift from Silvia Corvera (Addgene plasmid #42635)^{24 (link)}; EGFP-EEA1, a gift from Silvia Corvera (Addgene plasmid #42307)^{13 (link)}; EGFP-Rab5, a gift from Marci Scidmore (Addgene plasmid #49888); and mRFP-Rab5, a gift from Ari Helenius (Addgene plasmid #14437)^{69 (link)}. Cells were transfected with a total of 1 µg DNA (0.3 µg + 0.3 µg plasmid of interest + 0.4 µg blank DNA) using lipofectamine 3000 (Thermo Fisher Scientific). The DNA sequence for the N-terminal mutant of EEA1 carrying F41A and I42A, deficient in Rab5 binding, was synthesised and cloned into the TagRFP-T vector using the XhoI/BamHI sites. For the C-terminal binding mutant carrying R1375A, the synthesised sequence was cloned into the TagRFP-T vector using the XhoI/BamHI sites. It has been reported that drastic over-expression of APPL1 or EEA1 results in colocalisation of APPL1 and EEA1 on Rab5 endosomes; we, therefore, optimised this concentration by screening for this artefact and choosing conditions where we observed no overlap of APPL1 and EEA1.

Expression constructs encoding for human SNX9-pmCherryC1 (RRID:Addgene_27678), SNX9-EGFP, SNX9ΔPX-mCherry, SNX9ΔSH3-mCherry and CD28-EGFP, were provided by Prof. K. Gaus (University of New South Wales). PAmCherry expression backbone was obtained from Clontech. TCRζ-PamCherry was made by inserting a PCR product of TCR-PS-CFP2 into pPAmCherry-N1 using EcoRI +  AgeI. EGFP-Rab5 was obtained from Addgene (RRID:Addgene_31733).
CRISPR/Cas9 knockouts were generated as described in Ran et al., 2013 (link). Briefly, Jurkat T cells were transfected with two guide RNAs designed using the GPP sgRNA Designer (https://portals.broadinstitute.org/gpp/public/analysis-tools/sgrna-design) to target exon 2: AATGAACTGACGGTTAATGA and exon 3: GAAACATCAAAGGAGAACGA of the SNX9 genomic DNA sequence, together with Cas9-GFP expression plasmid (RRID:Addgene_79144). Twenty-four hours post transfection, single cells were FACS sorted based on GFP signal and seeded into 96-well plates. Cell clones were screened by using western blotting against SNX9 (#181856, 1:4000, Abcam). Clones lacking SNX9 eventually grew to an appropriate population within about 20 days.

EGFP-Rab5 (Addgene) was a gift from Arnab Gupta. Cells were transfected with 1 μg of Rab5 plasmid DNA to label early endosomes, respectively, by using Lipofectamine 3000 (Invitrogen). EGFP-CAAX [41 (link)] was a gift from Lei Lu. Cells were transfected with 1 μg EGFP-CAAX (Addgene) plasmid to mark the membrane. Cells were transfected with 1 μg of mCherry- Clathrin LC-15 (Addgene) to label clathrin-coated vesicles. To mark fast recycling endosomes, cells were transfected with 1 μg of mCherry- Rab 4a plasmid. Other treatments, if required, were performed 16 h after transfection.
Fixation of cells was performed by using 4% paraformaldehyde (Sigma-Aldrich) for 15 min at 37°C temperature.