Total RNA from heart tissues and H9C2 cells was extracted using TRIzol reagent (Invitrogen, Carlsbad, CA, USA). RNA concentrations were determined using a NanoDrop One spectrophotometer (Thermo Fisher Scientific). Then, the first-strand cDNA was reverse transcribed from 1μg RNA using PrimeScript RT Reagent Kit (TaKaRa, Tokyo, Japan). Quantitative reverse transcription polymerase chain reaction (RT-qPCR) was performed using a SYBR Green Premix Kit (Vazyme, Nanjing, China) in a Roche LightCycler 96 system (Roche, Switzerland). The primer sequences are listed in Table 1
Sybr green premix kit
Manufactured by Vazyme
Sourced in China
The SYBR Green Premix Kit is a reagent used for real-time quantitative PCR (RT-qPCR) analysis. It contains a buffer, DNA polymerase, and SYBR Green I dye, which binds to double-stranded DNA and emits fluorescence. The kit is designed to facilitate efficient and sensitive detection of target DNA sequences during RT-qPCR experiments.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (3 mentions)
Primescript rt reagent kit, by Takara Bio (3 mentions)
Quantstudio 3 real time pcr system, by Thermo Fisher Scientific (2 mentions)
Nanodrop one, by Thermo Fisher Scientific (2 mentions)
Lightcycler 96 system, by Roche (1 mentions)
Trizol reagent, by Takara Bio (1 mentions)
Primescript rt kit, by Takara Bio (1 mentions)
Trizol method, by Merck Group (1 mentions)
Reverse transcription kit, by Vazyme (1 mentions)
5 protocols using sybr green premix kit
1
RNA Extraction and RT-qPCR Analysis
2
Quantitative RT-PCR Analysis of Kidney Biomarkers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA of kidney tissues and cells was isolated using TRIzol Reagent (Invitrogen, Carlsbad, CA). Complementary DNA (cDNA) was synthesized using the PrimeScript RT Reagent Kit (TaKaRa, Tokyo, Japan). SYBR Green Premix Kit (Vazyme, Nanjing, China) was applied to perform the real-time PCR on QuantStudio 3 Real-time PCR System (Applied Biosystems, Foster City, CA, USA). The expression levels of genes were calculated using a comparative CT method, and GAPDH was used as an internal control. The sequences of the PCR primers in this study are listed in Table 1 .
Primer sequences for qRT-PCT.
| Gene | Sequence |
|---|---|
| Mouse-KIM-1 | F5′- ACATATCGTGGAATCACAACGAC-3′ |
| R5′- ACAAGCAGAAGATGGGCATTG-3′ | |
| Mouse-IL-1β | F5′-GCAACTGTTCCTGAACTCAACT-3′ |
| F5′-ATCTTTTGGGGTCCGTCAACT-3′ | |
| Mouse-IL-18 | F5′-GACTCTTGCGTCAACTTCAAGG-3′ |
| F5′-CAGGCTGTCTTTTGTCAACGA-3′ | |
| Mouse-GAPDH | F5′-AGGTCGGTGTGAACGGATTTG-3′ |
| F5′-TGTAGACCATGTAGTTGAGGTCA-3′ | |
| Human-NGAL | F5′-CCACCTCAGACCTGATCCCA-3′ |
| F5′-CCCCTGGAATTGGTTGTCCTG-3′ | |
| Human-KIM-1 | F5′-TGGCAGATTCTGTAGCTGGTT-3′ |
| F5′-AGAGAACATGAGCCTCTATTCCA-3′ | |
| Human-GAPDH | F5′-GGAGCGAGATCCCTCCAAAAT-3′ |
| F5′-GGCTGTTGTCATACTTCTCATGG-3′ |
3
Quantitative PCR Analysis of RNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA of cells and kidney tissues was separated using Trizol reagent following the manufacturer’s protocol (TaKaRa Bio Inc., Japan), RNA concentration was determined using OD absorbance at 260/280 nm. RNA (1,000 ng) was reverse-transcribed using a PrimeScript RT Reagent Kit (TaKaRa Bio Inc., Japan). Quantitative PCR was performed using SYBR Green Premix Kit (Vazyme Biotech Co.,Ltd., Nanjing, China) on a QuantStudio 3 real-time PCR system (Applied Biosystems, Foster City, CA, United States). The primers used in this study are listed in Table 1 . The mRNA expression levels were normalized to GAPDH and calculated using the 2–ΔΔCT method.
4
Quantifying TLR4 Expression in NRK-52E Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Using the Trizol method (Sigma, USA), total RNA was extracted from NRK-52E cells, and RNA concentration was determined by Nanodrop. The extracted RNA was reverse transcribed into cDNA using the PrimeScript RT kit (Takara, Japan). Later, the obtained cDNA was employed as a template for qRT-PCR analysis with the help of the SYBR Green Premix kit (Vazyme, China). Taking β-actin as an internal control gene, the relative expression level of TLR4 was calculated. The primer sequences used are shown in Table 1 .
Primer sequence used in qRT-PCR
| Gene name | Forward Primer (5’ to 3’) | Reverse Primer (5’ to 3’) |
|---|---|---|
| TLR4 | CGTATACGACGAGTTCCAGT | GGACTTGTTGGACGTCGAGA |
| β-actin | GGAGATTACTGCCCTGGCTCCTA | GACTCATCGTACTCCTGCTTGCTG |
5
Quantifying mRNA Expression Levels
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To validate mRNA expression levels, total RNA was extracted using Trizol reagent (Invitrogen, USA) and reverse-transcribed into cDNA using a Reverse Transcription Kit (Vazyme Biotech, China). A SYBR Green Premix Kit (Vazyme Biotech, China) was then used for RT-qPCR amplification, pre-denaturing cDNA at 95 °C for 10 min, followed by 40 cycles at 95 °C and 60 °C for 1 min. The relative mRNA expression levels of the target genes were normalized to β-actin expression using the 2△△Ct method. The primers used for RT-qPCR analysis are listed in Supplementary Table S1.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!