The FN1's promoter sequence was first amplified by PCR using forward primer (5′-3′CGCTCGAGTTCAGTGCAGTAAATATATC) and
reverse primer (5′-3′ ATGATATCTGGGACGGTCCCC
TCCCGCC), and cloned to the XhoI/EcoRV sites of pGL4.10 reporter plasmid (Promega, USA). The PDGFRB's promoter sequence was amplified using forward primer (5′-3′ ATCTCGAGACTCTTATGGTCCCCAACCCGT) and reverse primer (5′-3′ ATAGATCTCCAGATAGGGCGGG
CAGTCA), and cloned into XhoI/BglII sites of pGL4.10 plasmid. After 36 hours of STAB1 transfection, Firefly luciferase and Renilla luciferase were quantified with the Dual-Luciferase Reporter Assay system and the Stop & Glo Reagent kit according to the manufacturer's instruction (Promega, USA).
reverse primer (5′-3′ ATGATATCTGGGACGGTCCCC
TCCCGCC), and cloned to the XhoI/EcoRV sites of pGL4.10 reporter plasmid (Promega, USA). The PDGFRB's promoter sequence was amplified using forward primer (5′-3′ ATCTCGAGACTCTTATGGTCCCCAACCCGT) and reverse primer (5′-3′ ATAGATCTCCAGATAGGGCGGG
CAGTCA), and cloned into XhoI/BglII sites of pGL4.10 plasmid. After 36 hours of STAB1 transfection, Firefly luciferase and Renilla luciferase were quantified with the Dual-Luciferase Reporter Assay system and the Stop & Glo Reagent kit according to the manufacturer's instruction (Promega, USA).