Human cholangiocarcinoma cell lines HuCCT1, RBE, QBC939, and HCCC‐9810 were purchased from the Cell Bank of Type Culture Collection of Chinese Academy of Sciences and cultured in the RPMI‐1640 medium (HyClone) supplemented with 10% fetal bovine serum (Gibco). QBC939 and HCCC‐9810 cells were transfected with lentivirus vectors encoding short hairpin RNA (shRNA) targeting p62 (shp62) or negative control vectors (shCtrl) (Genechem) in the light of the manufacturer's directions, and stable cell lines with p62 knockdown were selected with 4ug/mL puromycin incubation for 14 days. The shp62 coding sequences were 5’‐CGTCAATAGCAACTGCTCCAA‐3′. The efficiency of p62 knockdown was validated by western blotting analysis.
Hucct1
Manufactured by National Collection of Authenticated Cell Cultures
Sourced in China
HuCCT1 is a cell line derived from a human cholangiocarcinoma. It is a well-characterized, immortalized cell line that can be used for in vitro studies related to cholangiocarcinoma.
Automatically generated - may contain errors
Lab products found in correlation
Hccc9810, by National Collection of Authenticated Cell Cultures (9 mentions)
Qbc939, by National Collection of Authenticated Cell Cultures (6 mentions)
Cclp 1, by National Collection of Authenticated Cell Cultures (5 mentions)
Rpmi 1640 medium, by Thermo Fisher Scientific (5 mentions)
Fetal bovine serum (fbs), by Thermo Fisher Scientific (4 mentions)
Rpmi 1640, by Thermo Fisher Scientific (3 mentions)
Rpmi 1640 complete medium, by Sartorius (2 mentions)
Hibec, by National Collection of Authenticated Cell Cultures (2 mentions)
Penicillin, by Thermo Fisher Scientific (2 mentions)
Streptomycin, by Thermo Fisher Scientific (2 mentions)
Hucct1, by Thermo Fisher Scientific (2 mentions)
Dulbecco modified eagle medium (dmem), by Thermo Fisher Scientific (2 mentions)
Shctrl, by Genechem (1 mentions)
Penicillin, by Merck Group (1 mentions)
Streptomycin, by Merck Group (1 mentions)
Rpmi 1640 medium, by Merck Group (1 mentions)
Thle 3, by American Type Culture Collection (1 mentions)
Hibepic, by American Type Culture Collection (1 mentions)
Frh 0201, by National Collection of Authenticated Cell Cultures (1 mentions)
Puromycin, by MedChemExpress (1 mentions)
19 protocols using hucct1
1
Establishment of p62-knockdown cell lines
2
Culturing human iCCA cell lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human iCCA cell lines HuCCT1 and RBE were purchased from the Cell Bank of Type Culture Collection of Chinese Academy of Sciences (Shanghai, China) and maintained in RPMI 1640 medium (Sigma-Aldrich, MO, USA) supplemented with 10% heat-inactivated fetal bovine serum (Gibco, USA), 100 U/mL penicillin, and 100 mg/mL streptomycin (Sigma-Aldrich). All cell lines were cultured at 37 °C in a humidified incubator with 5% CO2.
3
Cultivation of Intrahepatic Biliary Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Four ICC cell lines (CCLP-1, HCCC-9810, RBE and HuCCT-1) and a normal human intrahepatic biliary epithelial cell line (HIBEC) were purchased from Cell Bank of Type Culture Collection of Chinese Academy of Sciences, (Shanghai, China). Cells were cultivated according to the protocols from their supplier. All cell lines were grown in RPMI-1640 complete medium (Biological Industries, Kibbutz Beit-Haemek, Israel) supplemented with 10% fetal bovine serum (FBS; Moregate Biotech, Brisbane, Australia), and were cultured in an incubator of 37°C and 5% CO2.
4
Cultivation of Intrahepatic Biliary Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Three ICC cell lines (CCLP-1, RBE and HuCCT-1) and a normal human intrahepatic biliary epithelial cell line (HIBEC) were purchased from Cell Bank of Type Culture Collection of Chinese Academy of Sciences, (Shanghai, China). Cells were cultivated according to the protocols from their supplier. All cell lines were grown in RPMI-1640 complete medium (Biological Industries, Kibbutz Beit-Haemek, Israel) supplemented with 10% fetal bovine serum (FBS; Moregate Biotech, Brisbane, Australia), and were cultured in an incubator of 37°C and 5% CO2.
5
Culturing Human CCA Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The human CCA cell lines HuCCT1, QBC939, SK-ChA-1, HuH28, RBE, and Mz-ChA-1 were purchased from the Cell Bank of Type Culture Collection of Chinese Academy of Sciences (Shanghai, China). Cell lines were cultured in RPMI-1640 or DMEM medium with 10% FBS, 100 U/mL penicillin and 100 μg/mL streptomycin. Cells were incubated under 37°C, 5% CO2. DSG was dissolved with anhydrous ethanol, and diluted to different concentrations with medium.
6
Culturing Liver and Bile Duct Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Immortalized normal liver epithelial cells (THLE3) and human normal bile duct epithelial cell lines (HIBEpiC) were obtained from the American Type Culture Collection (ATCC, Manassas, VA, USA). The cells were cultured as specified by respective manufacturers. Two intrahepatic cholangiocarcinoma cell lines (HuCCT1 and RBE) were acquired from the Cell Bank of the Chinese Academy of Sciences, Shanghai, China. The cell lines were grown at 37 °C under 5% CO2 in a 1640 medium supplemented with 10% fetal bovine serum (FBS, Hyclone, USA). The cells were seeded at a density of 5 × 105 cells in a T25 culture flask and passaged every 4–5 days.
7
Cholangiocarcinoma Tissue and Cell Line Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The human tumor and paired para-tumor tissues and ICC specimens of the validation cohort were obtained from ICC patients undergoing hepatectomy at Renji Hospital affiliated to Shanghai Jiaotong University School of Medicine. Patient samples were obtained following informed consent and protocols that were approved by the ethical review committee of the World Health Organization's Collaborating Center for Research in Human Production (authorized by Shanghai Municipal Government). The cholangiocarcinoma cell line RBE, HuCCT1 and FRH-0201 were purchased from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China).
8
Establishing Cholangiocarcinoma Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The cholangiocarcinoma cell line QBC939 and HUCCT1 were purchased from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China). The human embryonic kidney 293T (HEK293T) cells were purchased from the American Type Culture Collection. QBC939 and HUCCT1 were all MTHFD1 WT genotype (MTHFD1+/+). QBC939, HUCCT1, and HEK293T cells were cultured in Dulbecco’s modified Eagle’s medium (Gibco). All cell lines were supplemented with 10% fetal bovine serum (Gibco), penicillin (100 mg/ml) and streptomycin (100 mg/ml) and were incubated in a humidified chamber with 5% CO2 at 37 °C. Gemcitabine, Methotraxate, and puromycin were purchased from MedChemExpress (MedChemExpress, Monmouth Junction, NJ).
9
Culturing Human Cholangiocarcinoma Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The human CCA cell lines HCCC-9810, QBC939 and HuCCT1 were obtained from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China). Human intrahepatic bile duct epithelial cells (HIBECs) were purchased from Beina Biotechnology Research Institute (http://www.bnbio.com/pro/p1/1/p_3391.html , Beijing, China). These cells were cultured in RPMI-1640 medium (Gibco; Thermo Fisher Scientific, Inc.) together with 10% fetal bovine serum (FBS), 100 mg/ml streptomycin plus, and 100 IU/ml of penicillin (Gibco; Thermo Fisher Scientific, Inc.) in an atmosphere of 5% CO2 at 37°C.
10
FGF1 Signaling Pathway in ICC Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The ICC cell lines RBE, HuCCT1 and HCCC9810 were all purchased from Cell Bank of the Chinese Academy of Sciences (Shanghai, China) and cultured in the RPMI‐1640 medium supplemented with 10% foetal bovine serum (Gibco, Waltham, MA) and 1% ampicillin/streptomycin (Gibco) in 5% CO2 resuscitation. Human recombinant FGF1 was purchased from PeproTech Company, and the inhibitor AP24534 was purchased from Selleck, the primary antibodies of SPRY1‐4, pan‐phospho‐Tyr, and β‐actin were bought from Santa Cruz Biotechnology (Santa Cruz, CA), antibodies of FGFR2, Grb2, pFRS2‐Tyr436, p‐ERK‐Tyr202/204 and the EMT antibody sampler kit were purchased from the Cell Signaling Technology (Danvers, MA), antibody of p‐FGFR2‐Tyr769 was from Biorbyt Company (Cambridge, UK).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!