Seqcap ez accessory kit v2

Manufactured by Roche

Sourced in Switzerland

The SeqCap EZ Accessory Kit v2 is a collection of laboratory equipment and reagents designed to support the preparation of DNA samples for next-generation sequencing. The kit includes necessary components for library construction, target enrichment, and sample processing.

Automatically generated - may contain errors

Lab products found in correlation

Seqcap ez hybridization and wash kit, by Roche (3 mentions) Qubit dsdna hs assay kit, by Thermo Fisher Scientific (2 mentions) Seqcap pure capture bead kit, by Roche (2 mentions) Seqcap he oligo kit, by Roche (1 mentions) Seqcap ez pure capture bead kit, by Roche (1 mentions) Seqcap ez library sr, by Roche (1 mentions) Seqcap ez library, by Roche (1 mentions) Phix control kit v3, by Illumina (1 mentions) Kapa library prep kit, by Roche (1 mentions) Miseq reagent kit v3, by Illumina (1 mentions) Miseq reagent nano kit v2, by Illumina (1 mentions) Miseq reagent micro kit v2, by Illumina (1 mentions) Agilent dna 1000 kit, by Agilent Technologies (1 mentions) Seqcap adapter kit a b, by Roche (1 mentions) 2100 bioanalyzer, by Agilent Technologies (1 mentions) Nanodrop, by Thermo Fisher Scientific (1 mentions) Hiseq 2500, by Illumina (1 mentions) Kapa hyper prep kit, by Roche (1 mentions) Nextseq 500, by Illumina (1 mentions) Qiaamp circulating nucleic acid kit, by Qiagen (1 mentions)

Spelling variants of this product

Nimblegen SeqCap EZ Accessory kit v2 (3 citations)

6 protocols using seqcap ez accessory kit v2

Roche-NimbleGen Double-Capture RNA-Seq Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

After library preparation with the Stranded RNA-Seq Library Preparation Kit (described above), samples were processed on the capture panels following the Roche-NimbleGen standard double-capture protocol (except for four samples – 3x FFPE lymphoma and Jurkat, where a single-capture approach was used), as described in the SeqCap EZ Library support literature (“NimbleGen SeqCap EZ User’s Guide [http://netdocs.roche.com/PPM/SeqCapEZLibrarySR_Guide_v3p0_Nov_2011.pdf]” and “Double Capture Technical Note [http://netdocs.roche.com/PPM/Double_Capture_Technical_Note_August_2012.pdf]”. In brief, libraries, probes and Roche hybridisation reagents (SeqCap EZ Accessory Kit v2 #07 145 594 001; SeqCap EZ Developer Enrichment Kit #06 471 684 001; SeqCap EZ Hybridisation and Wash Kit #05 634 261 001; SeqCap HE-Oligo Kit A #06 777 287 001; SeqCap HE-Oligo Kit B #06 777 317 001) were incubated overnight at 47 °C. Libraries were washed and then re-hybridised for an additional overnight step to further enrich the subsequent capture libraries.

Heyer E.E., Deveson I.W., Wooi D., Selinger C.I., Lyons R.J., Hayes V.M., O’Toole S.A., Ballinger M.L., Gill D., Thomas D.M., Mercer T.R, & Blackburn J. (2019). Diagnosis of fusion genes using targeted RNA sequencing. Nature Communications, 10, 1388.

+ Open protocol

+ Expand

Targeted Capture of FP Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

FP gene capture was performed using the SeqCap EZ Hybridization and Wash Kit (Roche, Basel, Switzerland), SeqCap EZ Accessory Kit v2 (Roche), SeqCap HE-Oligo Kit (Roche), and SeqCap EZ Pure Capture Bead Kit (Roche) following the manufacturer’s instructions for SeqCap EZ library SR (Roche), with minor modifications. Briefly, Biotin-labeled FP-gene fragments were used as hybridization probes, instead of the SeqCap EZ library (Roche). Equal amounts of all libraries (in total, 1 µg) were mixed with 135 ng of Biotin-labeled FP-gene fragments and were hybridized at 46°C for 72 h. Other procedures were performed in accordance with the manufacturer’s instructions.

Takahashi-Kariyazono S., Sakai K, & Terai Y. (2018). Presence–Absence Polymorphisms of Highly Expressed FP Sequences Contribute to Fluorescent Polymorphisms in Acropora digitifera. Genome Biology and Evolution, 10(7), 1715-1729.

+ Open protocol

+ Expand

Targeted Sequence Capture and Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols

A KAPA Library Prep Kit, SeqCap Pure Capture Bead Kit, SeqCap EZ Hybridization and Wash Kit, SeqCap EZ Accessory Kit v2, SeqCap Adapter Kit A/B and SeqCap HE-Oligo Kit A/B were obtained from Roche (Basel, Switzerland). A Qubit dsDNA HS Assay Kit was obtained from Thermo Fisher Scientific (Waltham, MA). An Agilent DNA 1000 Kit was obtained from Agilent Technologies (California, USA). MiSeq Reagent Nano Kit v2 (300 cycles), MiSeq Reagent Micro Kit v2 (300 cycles), MiSeq Reagent Kit v3 (150 cycles), and PhiX control kit v3 were obtained from Illumina (California, USA). All other chemicals and solvents were of the highest grade commercially available.

Katayama K., Nakashima S., Ishida H., Kubota Y., Nakano M., Fukami T., Sasaki Y., Fujita K.I, & Nakajima M. (2021). Characteristics of miRNA-SNPs in healthy Japanese subjects and non-small cell lung cancer, colorectal cancer, and soft tissue sarcoma patients. Non-coding RNA Research, 6(3), 123-129.

+ Open protocol

+ Expand

DNA Fragmentation and Library Preparation

Check if the same lab product or an alternative is used in the 5 most similar protocols

53 µl of 2 ng/µl DNA was fragmented using a Covaris M220 (Covaris, Inc., Woburn, MA, USA) aiming for a size range of 180–220 bp (50 W peak incident power, 20% duty factor, 200 cycles per burst, 280 s duration) then quality and concentration checked on a Bioanalyzer 2100 (Agilent Technologies, Santa Clara, CA, USA). Sample library preparation was done using the appropriate KAPA kit (KAPA Library Preparation Kit for Illumina, Roche). The Roche adapter index set A was used (SeqCap Adapter Kit A 96, Roche). 20 µl of the sample library was amplified in a pre-capture LM-PCR (ligation-mediated PCR, 50 µl; SeqCap EZ Accessory Kit v2, Roche; TS-PCR Oligo 1: AATGATACGGCGACCACCGAGA; TS-PCR Oligo 2: CAAGCAGAAGACGGCATACGAG; KAPA Hifi Hotstart; Ready mix 25 µl; Oligo mix 5 µl; program: 98 °C for 45 s, 9 cycles of 15 s at 98 °C, 30 s at 60 °C and 30 s at 72 °C, followed by 1 min at 72 °C). Libraries were cleaned, and concentrations quantified on a NanoDrop (ThermoFisher Scientific). Quality was again confirmed on the Bioanalyzer, aiming for a library with fragments in the range of 250–500 bp.

Schreiber M., Barakate A., Uzrek N., Macaulay M., Sourdille A., Morris J., Hedley P.E., Ramsay L, & Waugh R. (2019). A highly mutagenised barley (cv. Golden Promise) TILLING population coupled with strategies for screening-by-sequencing. Plant Methods, 15, 99.

+ Open protocol

+ Expand

cDNA Enrichment and Sequencing Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Target cDNA enrichment and sequencing was performed as previously described (14 (link)) using the SeqCap EZ Accessory kit v2 (07145594001, Roche, WI). Briefly, equimolar amounts of cDNA libraries were combined for a total mass of 1ug. Each of these libraries underwent multiplexed PCR with unique index oligonucleotides. The libraries were then hybridized with capture probes using the SeqCap EZ Hybridization and Wash Kit (05634261001, Roche, WI). Libraries were dried with heat in a vacuum and resuspended with hybridization reagents. Pooled capture probes for each region were added to the resuspended libraries and incubated for 20 hrs in a thermocycler at 47°C, with the lid temperature at 57°C. The captured multiplex cDNA samples then underwent stringent washing steps and were amplified using ligation-mediated PCR (LM-PCR). These post-capture PCR amplified libraries were pooled and sequenced on two lanes of an Illumina HiSeq 2500 with 150bp paired-end reads, yielding ~150 million read pairs per lane.

Diaz-Ortiz M.E., Seo Y., Posavi M., Carceles Cordon M., Clark E., Jain N., Charan R., Gallagher M.D., Unger T.L., Amari N., Skrinak R.T., Davila-Rivera R., Brody E.M., Han N., Zack R., Van Deerlin V.M., Tropea T.F., Luk K.C., Lee E.B., Weintraub D, & Chen-Plotkin A.S. (2022). GPNMB confers risk for Parkinson’s disease through interaction with alpha-synuclein. Science (New York, N.Y.), 377(6608), eabk0637.

+ Open protocol

+ Expand

Plasma ctDNA Isolation and Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols

The blood was centrifuged in Streck Cell-free tubes at 1600 g for 10 minutes at 4 °C and supernatant was transferred to a 1.5 ml Eppendorf tube, followed by 4 °C at 16000 g for 20 minutes to remove residual cells and debris. The supernatant of second centrifugation was collected for ctDNA extraction using QIAamp Circulating Nucleic Acid Kit (Qiagen) according to the manufacturer's instructions. DNA concentrations were determined by the Qubit dsDNA HS Assay Kit (Thermo Fisher). ctDNA libraries were constructed with the KAPA Hyper Prep Kit (Roche) according to the manufacturer's protocol. The concentrations and size distributions of the libraries were respectively analyzed by Qubit and Caliper. A customized set of biotinylated DNAs probe was used to capture targeted DNAs for plasma ctDNA with SeqCap EZ Accessory Kit V2 and SeqCap Pure Capture Bead Kit (Roche) following the standard protocols. Capture probe was designed to cover coding sequencing or hot exons frequently mutated in solid tumors. The captured DNAs were ampli ed by PCR, and the nal DNA concentrations and sizes were respectively measured by Qubit and Caliper. The captured libraries for plasma ctDNA were loaded into the NextSeq 500 (Illumina) for 75 bp paired-end sequencing according to the manufacturer's instructions.

LIU Y.L.Y., Guo N., Wu Y.t.W.Y.t., & Shi Y.h.S.Y.h. (2020). Characteristics of profiling the peripheral blood T-cell receptor β-chain repertoire in gastric cancer.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!