Nucleofector buffer

Manufactured by Lonza

The Nucleofector buffer is a specialized solution designed for use with the Nucleofector technology platform. It is formulated to facilitate the efficient transfer of nucleic acids, such as DNA or RNA, into a variety of cell types. The buffer's core function is to create the optimal conditions for electroporation-mediated gene delivery, enabling researchers to introduce genetic material into cells.

Automatically generated - may contain errors

Lab products found in correlation

Cas9 protein, by Thermo Fisher Scientific (1 mentions) Facsaria 2, by BD (1 mentions) Fetal calf serum (fcs), by Thermo Fisher Scientific (1 mentions) T cell growth media, by Lonza (1 mentions) P53 sirna, by Santa Cruz Biotechnology (1 mentions) Rpmi 1640, by Thermo Fisher Scientific (1 mentions) Nucleofector 2b device, by Lonza (1 mentions)

Spelling variants of this product

Human Monocyte Nucleofector buffer (9 citations) Nucleofector Solution buffer (3 citations)

2 protocols using nucleofector buffer

Generating HLA-I Negative iPSCs using CRISPR

Check if the same lab product or an alternative is used in the 5 most similar protocols

To establish HLA-I negative iPSCs, we designed CRISPR/Cas9 B2M gene editing experiment to target “GAGTAGCGCGAGCACAGCTA” DNA sequence of human B2M gene. Briefly, 7.5 μg Cas9 protein (Invitrogen, A36498) and 50 pmol B2M sgRNA were mixed to form 12 μL B2M ribonucleoprotein complex (B2M-RNP) and added into 100 μL Nucleofector buffer (Lonza). 4 × 10⁵ C55 iPSCs were transfected with the above B2M-RNP/Nucleofector solution by electroporator 2B Nucleofector with A-023 program. After electroporation, cells were transferred to Matrigel-coated 6-well plates and cultured in BioCISO+Y-27632 medium for 3–5 days. HLA-I expression was detected by staining with anti-HLA-ABC antibodies (Biolegend, 311406). One week later, HLA-ABC negative iPSCs were sorted by FACS AriaII (BD) into Matrigel-coated 24-well plates and grown in BioCISO+Y-27632 medium. Single cell clones of B2M KO iPSCs (C55-B2M^KO) were isolated by limiting dilution cloning (LDC).

Song C., Wang L., Li Q., Liao B., Qiao W., Li Q., Dong N, & Li L. (2022). Generation of individualized immunocompatible endothelial cells from HLA-I-matched human pluripotent stem cells. Stem Cell Research & Therapy, 13, 48.

+ Open protocol

+ Expand

Nucleofection of CD8 T Cells

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Nucleofection of CD8 T cells were performed following the manufacturer’s (Lonza) protocol, and as described in detail elsewhere (3 (link)). In short, 1×10⁶ CD8 T cells were resuspended in 100uL of Nucleofector buffer (Lonza) along with the RNP complex, with or without the p53siRNA (Santa Cruz, sc-29436) in a glass cuvette (Lonza). Nucleofector 2b device (Lonza) with Nucleofector program X001 was used. Following nucleofection, cell suspension was removed from cuvette, placed in Eppendorf tube with 100 uL of RPMI 1640 (Gibco) containing 10% fetal calf serum (Gibco). After incubation at 37°C for 10 min, the CD8 T cells were then placed in culture containing the T cell growth media (Lonza) or transferred intravenously into recipient mouse.

Kurup S.P., Moioffer S.J., Pewe L.L, & Harty J.T. (2020). P53 hinders CRISPR/Cas9 mediated targeted gene disruption in memory CD8 T cells in vivo. Journal of immunology (Baltimore, Md. : 1950), 205(8), 2222-2230.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!