Whole body Bcl2l13 knockout mice were generated by the Karolinska Center for Transgene Technologies using the CrisprCAS9 system. Two guide RNAs (sgRNA1: TCCTCTACGACTGCGTCTCT, sgRNA2: CTGCAGTCCATGCCAGCGGA) targeting exon 2 and 5 of Bcl2l13, respectively, were injected alongside Cas9 protein into C57BL/6NCrl zygotes twice. Out of the 38 animals born, three animals carried deletions around the guide RNA targeting exon 5. Out of these 3 founder animals, the animal carrying a 108 bp deletion (g.34512_34619del, NCBI Gene ID: 94044; g.120847678_120847785del, NCBI Reference Sequence: NC_000072.6) was chosen to establish the Bcl2l13 knockout mouse line. The C5024T mice were generated previously [8 (link)]. Whole body Parkin knockout mice were obtained by crossing mice with Parkin exon 7 flanked by loxP-sites [37 (link)] to β-actin-cre transgenic mice [38 (link)] followed by backcrossing to C57BL/6NCrl mice (Charles River, Germany). Whole body Ulk1 and Ulk2 knockout mice were created by mating Ulk1FL and Ulk2FL mice (The Jackson Laboratory, stock number 017976 and 017977, respectively) to β-actin-cre transgenic mice [38 (link)] and subsequent backcrossing for 5 generations to C57BL/6NCrl mice (Charles River, Germany). Animals were housed in a 12-hours light/dark cycle in standard ventilated cages and fed ad libitum with a normal chow diet.
C57bl 6ncrl mice
Manufactured by Charles River Laboratories
Sourced in Germany, France, United States, United Kingdom
C57BL/6NCrl mice are a widely used inbred strain of laboratory mice. They are a robust and genetically stable model commonly used in a variety of research applications.
Automatically generated - may contain errors
Lab products found in correlation
D12492, by Research Diets (2 mentions)
C57bl 6j, by Charles River Laboratories (2 mentions)
Tamoxifen, by Merck Group (2 mentions)
C57bl 6j, by Jackson ImmunoResearch (2 mentions)
Recombinant mouse gm csf, by Thermo Fisher Scientific (2 mentions)
Sprague dawley rat, by Charles River Laboratories (2 mentions)
Oasis cartridge, by Waters Corporation (1 mentions)
Soybean lox 1, by Merck Group (1 mentions)
Zymosan a, by Merck Group (1 mentions)
C57bl 6jico, by Charles River Laboratories (1 mentions)
Heparin tubes, by Sarstedt (1 mentions)
Nestlet, by Ancare (1 mentions)
D12451, by Research Diets (1 mentions)
B6.129 cg ccr2tm2 1ifc j, by Jackson ImmunoResearch (1 mentions)
B6.129s4 ccr2tm1ifc j, by Charles River Laboratories (1 mentions)
B6.129s4 ccr2tm1ifc j, by Jackson ImmunoResearch (1 mentions)
C57bl 6jrj mice, by Janvier Labs (1 mentions)
C57bl 6nj, by Jackson ImmunoResearch (1 mentions)
Dba 2j, by Jackson ImmunoResearch (1 mentions)
B6 cg tyrc 2j j mice, by Jackson ImmunoResearch (1 mentions)
104 protocols using c57bl 6ncrl mice
1
CRISPR-Cas9 Knockout Mouse Models
2
Intranasal Mn Exposure in C57BL/6 Mice
3
Mice Vocalization and Optogenetic Studies
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Wild-type C57BL/6NCrl mice (Charles River Laboratories, strain 027), NtsCre knock-in mice34 (link) (Jackson Laboratory, strain 017525) and Ai9 or Ai14 tdTomato mice35 (link) (Jackson Laboratory, strain 007909) were housed and bred in the animal facility at Stanford University in accordance with Institutional Animal Care and Use Committee (IACUC) guidance and were maintained on a 12-h light/dark cycle at temperature 70–75 °F and humidity 35–60%, with food and water provided ad libitum. Male mice of age 6–8 weeks were used for all adult social vocalization studies. Both male and female mice of age 6–8 weeks were used for all optogenetic stimulation and viral tracing studies. Neonatal mice were postnatal day 7 and were not sexed. All mouse experiments were approved by the Stanford University IACUC.
4
Isolation and Stimulation of Mouse Peritoneal Macrophages
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Mouse peritoneal resident macrophages were collected as described (23 (link)) by lavage from naive mice (6–8 week old C57BL/6NCrl mice; Charles River Laboratories). All animal studies were approved and performed in accordance with guidelines provided by the Vanderbilt Medical Standing Committee on Animals.
After centrifugation at 400 g and addition of DMEM + 10% FBS, macrophages (5 × 106 cells/ml) were incubated with zymosan A (200 μg/ml) and fatty acids or fatty acid hydroperoxides at 37°C for 30 min; the substrates were added in 2 μl ethanol per 0.5 ml cell incubation to give 20 μg/ml final concentration (equivalent to 60 μM 15S-HPEPE, 61 μM DHA, and 56 μM 17S-HPDHA). Incubations were stopped with two volumes of cold MeOH. After lysing with MeOH, the cell debris was removed by centrifugation at 10,000 rpm, the supernatant was mixed with three volumes of water, and the apparent pH was adjusted to approximately 3. The products were extracted on a 30 mg Oasis cartridge (Waters), eluted with MeOH, and analyzed by reversed-phase HPLC (RP-HPLC).
After centrifugation at 400 g and addition of DMEM + 10% FBS, macrophages (5 × 106 cells/ml) were incubated with zymosan A (200 μg/ml) and fatty acids or fatty acid hydroperoxides at 37°C for 30 min; the substrates were added in 2 μl ethanol per 0.5 ml cell incubation to give 20 μg/ml final concentration (equivalent to 60 μM 15S-HPEPE, 61 μM DHA, and 56 μM 17S-HPDHA). Incubations were stopped with two volumes of cold MeOH. After lysing with MeOH, the cell debris was removed by centrifugation at 10,000 rpm, the supernatant was mixed with three volumes of water, and the apparent pH was adjusted to approximately 3. The products were extracted on a 30 mg Oasis cartridge (Waters), eluted with MeOH, and analyzed by reversed-phase HPLC (RP-HPLC).
5
Lipoxidase Inhibition by PD1 and MaR1
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DHA and EPA were purchased from NuChek Prep, Inc (Elysian, MN). Soybean LOX-1 (lipoxidase, type V) was purchased from Sigma. C57BL/6NCrl mice (6–8 weeks) were purchased from Charles River Laboratories. Zymosan A was purchased from Sigma. We thank Professor Trond Hansen for providing a sample of synthetic PD1. PD1 and MaR1 were also purchased from Cayman Chemical.
6
Fingolimod administration post-MCAO in aged mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Thirty two C57BL/6NCrl mice (Charles River), 71–73 weeks of age, were used for this study. Although senescence is observed in mice at about 18 months (78 weeks), we chose a relatively younger age [the equivalent of 56 human years (Dutta and Sengupta, 2016 (link))] due to the high mortality of these mice following experimental stroke. Mice received saline or fingolimod (0.5 mg/kg) intraperitoneally at 2, 24 and 48 h post-MCAO. Behavioural assessments (cylinder and foot fault) were completed at baseline, 3 and 7 days post-stroke.
7
Isolation of Immune Cells from Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
C57BL/6NCrl mice and C57BL/6-Tg(TcraTcrb)425Cbn/Crl (OT-II) mice were purchased from Charles River Laboratories. Toll-like receptor 2 and 4 double KO mice (Tlr2−/−, Tlr4−/−) were provided by Jackson Laboratory. All animals were kept and bred under SPF conditions. For isolation of B cells, T cells and bone marrow, only female mice aged 8–10 weeks were used. Germfree C57BL/6J mice were bred and housed in our own gnotobiotic facility. Animal experiments were reviewed and approved by the responsible institutional review committee and the local authorities.
8
Acclimating C57BL/6NCrl Mice for Experiments
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Female 8- to 9-week-old C57BL/6NCrl mice were obtained from Charles River Laboratories. Mice were accommodated in SPF conditions while sterile food (normal mouse chow, LabDiets 5K67, or non-fluorescent food, LabDiets 5V5R) and water were provided ad libitum. Sterile vinyl isolators equipped with food, water and bedding were used to house the mice within the Harvard Medical School animal facility. Mice had at least 1 week of acclimatization to the facility environment before any experiment. All experiments were conducted in compliance with US National Institutes of Health guidelines and approved by the Harvard Medical Area Standing Committee on Animals.
9
Depilation of Female Mouse Skin
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Experiments were carried out using female C57BL6/NCrl mice (Charles River, L'Arbresle, France), aged 7 weeks on arrival (time at which the hair follicles are in telogen phase) (Muller‐Rover et al. 2001 ). For depilation, mice were anesthetized (3 L/min oxygen, 3–4% isoflurane [Isovet, Primacal Healtcare UK Ltd.]) in an induction box and maintained under anesthesia by mask (2.5% isoflurane; 1.5 L/min). The back of the mice was depilated with melted wax (Aries, Carros, France). Mice were thereafter housed individually for 5 days.
10
Ovariectomized Mouse Model for Phytoestrogen Study
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All animal experiments were performed in compliance with the guide for the care and use of laboratory animals (National Research Council, 2011 ) and were approved by the local ethical committee (No. 1026 and 1113, Regierungspräsidium Tübingen, Germany). Female C57BL/6NCrl mice (n=96) were purchased from Charles River (Sulzfeld, Germany). The mice received a standard mouse feed (ssniff® R/M-H, V1535-300, Ssniff, Soest, Germany). At 2 weeks prior to OVX, the diet of the respective animals was changed to a phytooestrogen-reduced chow (ssniff® R/M-H Phytooestrogenarm, Ssniff).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!