Lightcycler 1.5 real time pcr system

Manufactured by Roche

Sourced in Switzerland, Germany, United States

The LightCycler 1.5 real-time PCR system is a laboratory instrument designed for performing real-time polymerase chain reaction (PCR) analysis. It is capable of detecting and quantifying specific DNA sequences in real-time during the amplification process.

Automatically generated - may contain errors

Lab products found in correlation

Superscript 2 reverse transcriptase, by Thermo Fisher Scientific (9 mentions) Sybr premix ex taq, by Takara Bio (9 mentions) Topreal qpcr 2 premix with sybr green, by Enzynomics (3 mentions) Rneasy kit, by Takara Bio (2 mentions) Sybr green, by Takara Bio (2 mentions) Nanodrop spectrophotometer, by Thermo Fisher Scientific (2 mentions) Reverse transcription kit, by Takara Bio (1 mentions) Cfx manager software 3, by Bio-Rad (1 mentions) Qiaquick pcr purification kit, by Qiagen (1 mentions) Miscript sybr green pcr kit, by Roche (1 mentions) Snord95, by Qiagen (1 mentions) Mirneasy mini kit, by Qiagen (1 mentions) Miscript 2 rt kit, by Qiagen (1 mentions) Qiaamp viral rna mini kit, by Qiagen (1 mentions) Superreal premix plus sybr green, by Tiangen Biotech (1 mentions) Fastking rt kit, by Tiangen Biotech (1 mentions) Taqman probe, by Thermo Fisher Scientific (1 mentions) Rn01775763 g1, by Thermo Fisher Scientific (1 mentions) High capacity cdna reverse transcription kit, by Toyobo (1 mentions) Qiazol reagent, by Qiagen (1 mentions)

18 protocols using lightcycler 1.5 real time pcr system

Real-time PCR Analysis of Osteoclast Markers

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Real-time PCR was performed as reported previously [41 (link)]. Briefly, total RNA was extracted using TRI-solution (Bioscience; Seoul, Republic of Korea) following the manufacturer’s instructions. Single-stranded cDNA was synthesized from 1 μg of total RNA using SuperScript II Reverse Transcriptase (Invitrogen, Carlsbad, CA, USA). We performed real-time PCR using a LightCycler 1.5 real-time PCR system (Roche Diagnostics, Basel, Switzerland) and the SYBR Premix Ex Taq (Takara Bio Inc., Shiga, Japan). The primer sequences used were as follows: TRAP (Acp5), 5′-TCCCCAATGCCCCATTC-3′ and 5′-CGGTTCTGGCGATCTCTTTG-3′; Cathepsin K (Ctsk), 5′-GGCTGTGGAGGCGGCTAT-3′ and 5′-AGAGTCAATGCCTCCGTTCTG-3′; Dcstamp, 5′-CTTCCGTGGGCCAGAAGTT-3′ and 5′-AGGCCAGTGCTGACTAGGATGA-3′; Nfatc1, 5′-ACCACCTTTCCGCAACCA-3′ and 5′-TTCCGTTTCCCGTTGCA-3′.

Ihn H.J., Kim J.A., Lim S., Nam S.H., Hwang S.H., Lim J., Kim G.Y., Choi Y.H., Jeon Y.J., Lee B.J., Bae J.S., Kim Y.H, & Park E.K. (2019). Fermented Oyster Extract Prevents Ovariectomy-Induced Bone Loss and Suppresses Osteoclastogenesis. Nutrients, 11(6), 1392.

+ Open protocol

+ Expand

Quantitative Real-Time PCR Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was prepared using TRI-solution (Bioscience, Seoul, Korea) and cDNA was synthesized from 1 μg of total RNA using SuperScript II Reverse Transcriptase (Invitrogen, Carlsbad, CA). Real-time PCR was performed in a LightCycler 1.5 Real-time PCR system (Roche Diagnostics, Rotkreuz, Switzerland) using TOPreal qPCR 2× PreMIX with SYBR green (Enzynomics, Daejeon, Korea). The amplification conditions were as follows: initial denaturation at 95°C for 10 min, followed by 40 cycles of 10 sec at 95°C, 15 sec at 60°C, and 10 sec at 72°C. The primers used for PCR were as previously described [18 (link)].

Ihn H.J., Lee D., Lee T., Kim S.H., Shin H.I., Bae Y.C., Hong J.M, & Park E.K. (2015). Inhibitory Effects of KP-A159, a Thiazolopyridine Derivative, on Osteoclast Differentiation, Function, and Inflammatory Bone Loss via Suppression of RANKL-Induced MAP Kinase Signaling Pathway. PLoS ONE, 10(11), e0142201.

+ Open protocol

+ Expand

Quantitative Analysis of Osteoclast Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted using TRI-solution (Bio Science Technology, Daegu, Korea), according to the manufacturer’s instructions, and complementary DNA (cDNA) was synthesized using SuperScript II Reverse Transcriptase (Invitrogen, Carlsbad, CA, USA). Quantitative real-time PCR was performed using a LightCycler 1.5 real-time PCR system (Roche Diagnostics, Basel, Switzerland) and SYBR Premix Ex Taq (Takara Bio Inc., Shiga, Japan). Primer sequences for osteoclast-specific genes: TRAP (Acp5), 5′-TCCCCAATGCCCCATTC-3′ and 5′-CGGTTCTGGCGATCTCTTTG-3′; Ctsk, 5′-GGCTGTGGAGGCGGCTAT-3′ and 5′-AGAGTCAATGCCTCCGTTCTG-3′; Dcstamp, 5′-CTTCCGTGGGCCAGAAGTT-3′ and 5′-AGGCCAGTGCTGACTAGGATGA-3′; Nfatc1, 5′-ACCACCTTTCCGCAACCA-3′ and 5′-TTCCGTTTCCCGTTGCA-3′.

Lim S., Ihn H.J., Kim J.A., Bae J.S., Kim J.E., Bae Y.C., Shin H.I., Kim T.H, & Park E.K. (2023). Suppressive effects of (-)-tubaic acid on RANKL-induced osteoclast differentiation and bone resorption. Animal Cells and Systems, 27(1), 1-9.

+ Open protocol

+ Expand

Osteoclastogenesis Regulation by KP-A038

Check if the same lab product or an alternative is used in the 5 most similar protocols

Bone marrow-derived macrophages were cultured in 6-well plates with or without 5 μM KP-A038 in osteoclast-inducing media. Total RNA was extracted using TRI-solution (Bioscience, Seoul, South Korea) according to the manufacturer’s instructions. cDNA was synthesized using SuperScript II Reverse Transcriptase (Invitrogen, Carlsbad, CA, United States). Real-time PCR was performed using a LightCycler 1.5 real-time PCR system (Roche Diagnostics, Basel, Switzerland) and the SYBR Premix Ex Taq (Takara Bio Inc., Shiga, Japan) (Ihn et al., 2018 (link)). The primer sequences used in real-time PCR analysis were: Acp5, 5′-TCCCCAATGCCCCATTC-3′ and 5′-CGGTTCTGGCGATCTCTTTG-3′; Ctsk, 5′-GGCTGTGGAG GCGGCTAT-3′ and 5′-AGAGTCAATGCCTCCGTTCTG-3′; Mmp9, 5′-AAAGACCTGAAAACCTCCAACCT-3′ and 5′-GCCCGGGTGTAACCATAGC-3′; Dcstamp, 5′-CTTC CGTGGGCCAGAAGTT-3′ and 5′-AGGCCAGTGC TGACTAGGATGA-3′; Nfatc1, 5′-ACCACCTTTCCGCAACCA-3′ and 5′-TTCCGTTTCCCGTTGCA-3′; Irf8, 5′-GA TCGAACAGATCGACAGCA-3′ and 5′-AGCACAGCGTAA CCTCGTCT-3′; Bcl6, 5′-ATGAGATTGCCCTGCATTTC-3′ and 5′-TTCTTCCAGTTGCAGGCTTT-3′; Ifng, 5′-TCAAGT GGCATAGATGTGGAAGAA-3′ and 5′-TGGCTCTGCAGGATT TTCATG-3′; Prdm1, 5′-TTCTTGTGTGGTATTGTCGGG ACTT-3′ and 5′-TTGGGGACACTCTTTGGGTAGAGTT-3′.

Ihn H.J., Lee T., Lee D., Bae J.S., Kim S.H., Jang I.H., Bae Y.C., Shin H.I, & Park E.K. (2019). Inhibitory Effect of KP-A038 on Osteoclastogenesis and Inflammatory Bone Loss Is Associated With Downregulation of Blimp1. Frontiers in Pharmacology, 10, 367.

+ Open protocol

+ Expand

Quantification of RBPJ Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from CD59⁻ and CD59⁺ cells of patients with PNH and normal controls, and from mononuclear cells, respectively, with RNeasy kit (Takara Bio, Inc.). A Reverse transcription kit (Takara Bio, Inc.) was used to synthesize cDNA from 1 µg total RNA and was purified using the QIAquick PCR Purification Kit (Qiagen, Inc.). QuantiTect SYBR Green PCR Kit (Tli RNaseH Plus; Takara Bio, Inc.) and Light Cycler 1.5 Real-Time PCR System (Roche Diagnostics, Indianapolis, IN, USA) were used to perform RT-qPCR in duplicates. Specific primers designed to amplify cross-exons of the RBPJ gene (158 bp) are detailed in Table III. The thermocycling conditions were as follows: Initial denaturation at 95°C for 30 sex; followed by 45 cycles of denaturation at 94°C for 5 sec, annealing at 60°C for 30 sec and extension at 70°C for 30 sec. A final extension was conducted at 72°C for 10 min. Bio-Rad CFX Manager software 3.1 (Bio-Rad Laboratories, Inc.) was used to analyze the melting and amplification curves (quantitative curve), and the quantitative cycle (Cq) values of each group was determined. The relative quantitative multiplier of each group (relative fold) was expressed by 2^−ΔΔCq value (19 (link)) and used for statistical analysis.

Li L., Liu H., Wang H., Liu Z., Chen Y., Li L., Song J., Wang G, & Fu R. (2019). Abnormal expression and mutation of the RBPJ gene may be involved in CD59− clonal proliferation in paroxysmal nocturnal hemoglobinuria. Experimental and Therapeutic Medicine, 17(6), 4536-4546.

+ Open protocol

+ Expand

Quantitative Real-time PCR Protocol

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from cells using the TRI-solution (Bioscience, Seoul, Korea), and 1 μg of total RNA was reverse-transcribed using SuperScript II reverse transcriptase (Invitrogen, Carlsbad, CA, USA). Quantitative real-time polymerase chain reaction (PCR) was performed in a LightCycler 1.5 real-time PCR system (Roche Diagnostics, Rotkreuz, Switzerland) using TOPreal qPCR 2× PreMIX with SYBR green (Enzynomics, Daejeon, Korea). The amplification conditions consisted of an initial denaturation step at 95°C for 10 min, followed by 45 cycles of denaturation for 10 s at 95°C, annealing for 15 s at 60°C, and extension for 10 s at 72°C. The primers used for the PCR were as described previously [19 (link)].

Ihn H.J., Lee T., Kim J.A., Lee D., Kim N.D., Shin H.I., Bae Y.C, & Park E.K. (2017). OCLI-023, a Novel Pyrimidine Compound, Suppresses Osteoclastogenesis In Vitro and Alveolar Bone Resorption In Vivo. PLoS ONE, 12(1), e0170159.

+ Open protocol

+ Expand

Quantitative Real-Time PCR for mRNA Expression

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from cells using the TRI-solution (Bioscience, Seoul, Korea), and the mRNA was reverse-transcribed by SuperScript II reverse transcriptase (Invitrogen, Carlsbad, CA, USA). Quantitative real-time PCR was performed in a LightCycler 1.5 real-time PCR system (Roche Diagnostics, Basel, Switzerland) using TOPreal qPCR 2× PreMIX with SYBR green (Enzynomics, Daejeon, Korea). The primers and conditions used for PCR were as previously described (31 (link)).

Ihn H.J., Kim J.A., Bae Y.C., Shin H.I., Baek M.C, & Park E.K. (2017). Afatinib ameliorates osteoclast differentiation and function through downregulation of RANK signaling pathways. BMB Reports, 50(3), 150-155.

+ Open protocol

+ Expand

Osteoclastogenic Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

To analyze the mRNA expression of osteoclastogenic factors, BMMs were cultured with DPHC (75 μg/mL) or vehicle for four days. Total RNA was isolated with the TRI solution (Bioscience, Seoul, Korea) and used for cDNA synthesis. Real-time PCR was conducted on a LightCycler 1.5 real-time PCR system (Roche Diagnostics, Basel, Switzerland) using the SYBR Premix Ex Taq (Takara Bio Inc., Shiga, Japan). The following mouse primer sequences were used: Acp5 or TRAP, 5′-TCCCCAATGCCCCATTC-3′ and 5′-CGGTTCTGGCGATCTCTTTG-3′; Ctsk, 5′-GGCTGTGGAGGCGGCTAT-3′ and 5′-AGAGTCAATGCCTCCGTTCTG-3′; Dcstamp, 5′-CTTCCGTGGGCCAGAAGTT-3′ and 5′-AGGCCAGTGCTGACTAGGATGA-3′; Nfatc1, 5′-ACCACCTTTCCGCAACCA-3′ and 5′-TTCCGTTTCCCGTTGCA-3′.

Ihn H.J., Kim J.A., Cho H.S., Shin H.I., Kim G.Y., Choi Y.H., Jeon Y.J, & Park E.K. (2017). Diphlorethohydroxycarmalol from Ishige okamurae Suppresses Osteoclast Differentiation by Downregulating the NF-κB Signaling Pathway. International Journal of Molecular Sciences, 18(12), 2635.

+ Open protocol

+ Expand

Quantitative PCR Validation of miRNA Dysregulation

Check if the same lab product or an alternative is used in the 5 most similar protocols

Quantitative PCR assay was used to confirm the miRNAs (miR-451 and miR-885-5p) that were found to be differentially regulated in the microarray experiment. Total RNA was isolated from cells using Qiagen miRNeasy Mini Kit and RNA quantity was measured with the NanoDrop Spectrophotometer (Thermo Scientific, USA). Then, 2 μg RNA was reverse-transcribed with a specific stem-loop primer using miScript II RT Kit (Qiagen, Valencia, CA, USA). Real-time PCR was performed using miScript SYBR Green PCR Kit on a Lightcycler 1.5 Real-Time PCR System (Roche Diagnostics, Germany). Primers for mature miR-451, miR-885-5p SNORD95, and U6 were purchased from Qiagen (Valencia, CA, USA). The PCR reactions were performed at 95°C for 10 min, followed by 40 cycles at 95°C for 15 s and at 60°C for 30 s. The specificity of the PCR products was analyzed by the melting curve analysis. The relative expression levels of miRNAs were normalized to the average amounts of U6 and SNORD95 snRNA using the 2^−ΔΔCt formulation (22 (link)).

Alural B., Duran G.A., Tufekci K.U., Allmer J., Onkal Z., Tunali D., Genc K, & Genc S. (2014). EPO Mediates Neurotrophic, Neuroprotective, Anti-Oxidant, and Anti-Apoptotic Effects via Downregulation of miR-451 and miR-885-5p in SH-SY5Y Neuron-Like Cells. Frontiers in Immunology, 5, 475.

+ Open protocol

+ Expand

Inhibiting PEDV Infection via LiCl

Check if the same lab product or an alternative is used in the 5 most similar protocols

To determine the inhibitory effects of LiCl on PEDV infection, real-time quantitative PCR was performed. PEDV-infected Vero cells treated by LiCl were subjected to RNA extraction with a QIAamp Viral RNA Mini Kit (Qiagen, Germany). Subsequent reverse transcription was performed using random primers and the amplification included 42 °C for 1 h and a final extension at 72 °C for l0 min. The reverse transcription products were subjected to real-time PCR. Real-time quantitative PCR, targeting the S gene of PEDV was carried out with the primers shown in Table 1, using a Lightcycler 1.5 Real Time PCR System (Roche, Germany) and SYBR Premix Ex Taq (TaKaRa, Janpan) according to the instructions of the manufacturer. The relative RNA expression levels were calculated by the 2^−∆∆Ct method, using beta-actin as an internal control for normalization. The mean RNA level of the mock-treated group was set at 1.00.Table 1

Sequences of the primers used for real-time quantitative PCR.

Table 1

Primer pairs	PCR product in length (bp)
Sense 5′-TAACAAAACACTTGATGAGATT-3′	S (250)
Antisense 5′-CCCACCACGGCCACTTGATATATG-3′
Sense 5′- AGCAAGCAGGAGTATGACGAGT −3′	Beta-actin (93)
Antisense 5′- CAAGAAAGGGTGTAACGCAACT −3′

Li H.J., Gao D.S., Li Y.T., Wang Y.S., Liu H.Y, & Zhao J. (2018). Antiviral effect of lithium chloride on porcine epidemic diarrhea virus in vitro. Research in Veterinary Science, 118, 288-294.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!