Seramir exosome rna amplification kit
The SeraMir™ Exosome RNA Amplification Kit is a laboratory tool designed to amplify RNA extracted from exosomes. It provides a method for generating high-quality cDNA from small amounts of exosomal RNA samples.
Lab products found in correlation
32 protocols using seramir exosome rna amplification kit
Extraction and Quantification of RNA from Tissues and Serum
Urinary exosomal miRNA isolation and analysis
Exosome Isolation and Characterization from Serum
To verify that pellets were exosomes, we performed transmission electron microscopy (TEM), nanoparticle tracking analysis (NTA) and western blotting.
Quantitative Analysis of miR-34c Expression
U6-F: CTCGCTTCGGCAGCACA, U6-R: AACGCTTCACGAATTTGCGT,
Stem-loop miR34c: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGCAATC,
q-miR34c-F: AGGCAGTGTAGTTAGCTG, q-miR-R: GTGCAGGGTCCGAGGT
Exosomal miRNA Extraction and Analysis
Serum Exosome Isolation and RNA Extraction
Profiling Brain-specific miRNAs in hiPSC-NSC-EVs
Serum Extracellular Vesicle RNA Extraction
Serum RNA was isolated using the TRIzol‐LS reagent (Invitrogen). In brief, serum (300 μL) was lysed in TRIzol‐LS (900 μL) before the RNA was phase separated using chloroform (240 μL), precipitated with 100% isopropanol, and washed in 75% EtOH. Finally, the RNA was eluted in RNase‐free water (30 μL).
The RNA concentration was assessed using the NanoDrop 2000 spectrophotometer (Thermo Scientific), while its yield and size distribution were analyzed using the Agilent 2100 Bioanalyzer and RNA 6000 Nano kit (Agilent Technologies, Foster City, CA, USA).
Profiling EEC and EV RNA Expression
Profiling Adipocyte-Derived Extracellular Vesicles
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!