Mic qpcr cycler

RNA was isolated using TRIzol reagent (Thermo Fisher Scientific) and purified using a Direct-zol MiniPrep kit (Zymo Research) according to the manufacturer’s instructions, including treatment with DNase I. cDNA was synthesised using Tetro cDNA synthesis kit (Bioline). qPCR was performed using SYBR Premix Ex Taq II (Takara) and run on a Light Cycler 480 (Roche) or Mic qPCR Cycler (Bio Molecular Systems). Primer sequences used were obtained from the Harvard PCR Primer Bank (http://pga.mgh.harvard.edu/primerbank/) and are included in Supplementary Table 1. Differences between conditions were calculated using the ΔΔCt method.

Total RNA was isolated from the colon tissues or CCD-18Co cells using TRIzol reagent (Ambion, Austin, TX, USA) according to the manufacturer’s instructions. The quality of the extracted RNA was measured using a NanoDrop Spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA) and was then reverse transcribed into cDNA using a High-Capacity cDNA Reverse Transcription kit (Applied Biosystems, Waltham, MA, USA). qRT-PCR was performed in the Mic qPCR Cycler (Bio Molecular Systems, Upper Coomera, Australia) using Maxima SYBR-green Master Mix (Thermo Fisher Scientific). All the mouse- or human-specific primers were purchased from Thermo Fisher Scientific. The sequences of primers are obtained from the PrimerBank database [46 (link),47 (link),48 (link)] with detailed information listed in Table S1. The results from target genes were normalized to glyceraldehyde-3-phosphate dehydrogenase and expressed to the young mice using the 2^−ΔΔCt method.

Total RNA was isolated by using an RNA extraction kit (Favorgen, Taiwan). 250 ng of total RNA was treated with RNase-free DNase (Sigma-Aldrich, St. Louis, MO, USA) for 15 min. After the inactivation of DNase with EDTA and heating, RNA was reverse transcribed using First Strand cDNA Synthesis Kit (Thermo Fisher Scientific) according to the manufacturer's instructions. Quantitative RT-PCR was performed on cDNA samples using the Luna qPCR master mix (NEB, Ipswich, MA, USA) by using the Mic qPCR Cycler (Bio Molecular Systems, Australia). Relative mRNA levels are presented as values of 2^[Ct(Rpl32)–Ct(gene of interest)]. For data presentation, the mRNA level in the control cell was set to 1. The sequences of the forward and reverse primers are shown in Table 1.

All RNA samples were treated with DNAse (Invitrogen, Carlsbad, CA, USA) according to the manufacturer´s instructions. AffinityScript QPCR cDNA Synthesis kit (Agilent Technologies, Santa Clara, CA, USA) was used for cDNA synthesis according to manufacturer’s instructions. qRT-PCR was performed using the Brilliant II SYBR Green QPCR Master Mix kit in a Mic qPCR Cycler (Bio Molecular Systems, Upper Coomera, Australia). For each qRT-PCR run, a negative control reaction for each primer pair using RNA with no reverse transcriptase treatment was included. Relative expression between the indicated conditions was determined through the ΔΔCt method as developed before [48 (link)]. The 16S ribosomal RNA gene was used for normalization, using the set of primers 16S Fw/16S Rv [49 (link)]. For ribA, ribN, ribD and tonB, the sets of primers used were ribA Fw/ribA Rv, ribN Fw/ribN Rv, ribD Fw/ribD Rv and tonB Fw/tonB Rv, respectively [49 (link)]. For the fur, sodA, vctA and vctC genes, the set of primers used for qRT-PCR analysis were fur Fw/fur Rv, SODFe Fw/SODFe Rv, vctA Fw/vctA Rv and vctC Fw/vctC R, respectively. The sequence of these primers is shown in Supplemental Table S1.

Cells were seeded at a density of 500,000 cells/well in 6 well plates and treated after 24 h. Cells were harvested 48 h after treatment. Total RNA was isolated by using the RNeasy Plus Mini Kit following the manufacturer's instructions (Qiagen). cDNA synthesis was performed using the iScript Select cDNA synthesis kit (Bio-Rad). qPCR was performed using the MIC qPCR cycler (BioMolecular Systems) and TaqMan gene expression assays for STAT5a (Hs00559637_g1), STAT5b (Hs00560026_m1), PSA/KLK3 (Hs02576345_m1), Bcl-xL (Hs00236329_m1), Cyclin D1 (Hs01050839_m1), and HPRT1 (Hs02800695_m1, all Applied Biosystems). HPRT1 was used as a reference. The micPCR software was used for the determination of Ct values. ΔCt = Ct_GOI-Ct_HPRT1 values were calculated and expressed as 2^-ΔCt.

The detection and quantification of Microsporidia MB were done with specific primers (MB18SF, CGCCGGCCGTGAAAAATTTA; MB18SR, CCTTGGACGTGGGAGCTATC) previously designed to detect Microsporidia MB in An. arabiensis [10 (link), 11 (link)]. Briefly, a 10-µL polymerase chain reaction (PCR) master mix consisting of 2 µL HOT FIREPol Blend Master Mix Ready to Load (Solis BioDyne, Estonia; mix components included HOT FIREPol DNA polymerase, 2 mM of each deoxynucleoside triphosphate and 7.5 mM magnesium chloride), 5 µL of nuclease-free PCR water, 0.5 µL of 5 pmol µL⁻¹ forward and reverse primers, and 1 µL of the sample template, was prepared. The mixture was incubated in a thermocycler set up as follows: initial denaturation at 95 ˚C/15 min, followed by 35 cycles of denaturation at 95˚C/60 s, primer annealing for 90 s at 62 ˚C, extension at 72 ˚C for 60 s, and a final chain elongation step of 72 ˚C for 5 min. A qPCR reaction carried out using the MB18SF/MB18SR primers on a MIC qPCR cycler (Bio Molecular Systems, Australia) was used to determine the intensity of Microsporidia MB infection. These data were normalized by using Anopheles host ribosomal S7 gene primers (S7F, TCCTGGAGCTGGAGATGAAC; S7R, GACGGGTCTGTACCTTCTGG) [21 (link)].

Total RNA was isolated using an RNA Purification Kit (Thermo Fisher Scientific). Total RNA (200 ng) was treated with RNase-free DNase (Sigma Aldrich) for 15 min. Following the inactivation of DNase with Ethylenediaminetetraacetic acid (EDTA) and heating, RNA was reverse transcribed using a First Strand cDNA Synthesis Kit (Thermo Fisher Scientific) according to the manufacturer’s instructions. Quantitative real time polymerase chain reaction (RT-PCR) (qPCR) was performed with cDNA samples using the Power SYBR Green Master Mix and Mic qPCR Cycler (Bio Molecular Systems). The relative mRNA level was calculated as values of 2^{(Ct(β-actin) − Ct(gene of interest))}. For data presentation, the mRNA level in control cells was set to 1. The sequences of the forward and reverse primers are as follows: β actin, 5’-GGCTGTATTCCCCTCCATCG-3’ and 5’-CCAGTTGGTAACAATGCCATGT-3’; Ccna1, 5’-TGATGCTTGTCAAATGCTCAGC-3’ and 5’-AGGTCCTCCTGTACTGCTCAT-3’; Ccna2, 5’-GCCTTCACCATTCATGTGGAT-3’ and 5’-TTGCTGCGGGTAAAGAGACAG-3’.