Pronuclear injection with 5 ng/μL of gRNA/Cas9 expressing plasmid (for Pate1, Pate2 and Pate3) was performed as previously reported (Mashiko et al., 2013 (link); Noda et al., 2017 (link)). The crRNA and tracrRNA (Sigma) were diluted with nuclease free water (non-DEPC treated, Ambion). The mixture was denatured at 95°C for 1 minute and allowed to anneal by cooling gradually to room temperature (~1 hour). Each gRNA was mixed with Cas9 protein solution (Thermo Fisher Scientific) and T10E0.1 buffer (10 mM Tris-HCl, 0.1 mM EDTA, pH 7.4), and then incubated at 37°C for 5 minutes to prepare the gRNA/Cas9 RNPs. For multiple gene targeting, we prepared the gRNA/Cas9 RNP solution separately and then combined them [final concentration: 30 ng/μL (≈ 200 nM) Cas9 for 20 ng/μL (≈ 600 nM) of each gRNA (Table S2 )]. After centrifugation at 20,000 g at 4°C for 10 minutes, the mixture was used for pronuclear injection (for Clpsl2, Epp13, Rnase13, Gm1110, Glb1l2, Glb1l3).
Tracrrna
Manufactured by Merck Group
Sourced in United States, Germany
TracrRNA is a laboratory reagent used in CRISPR gene editing technology. It functions as a component of the CRISPR-Cas9 system, facilitating the targeted modification of specific DNA sequences. The core purpose of TracrRNA is to assist in guiding the Cas9 enzyme to the desired genomic target for precise gene editing.
Automatically generated - may contain errors
Lab products found in correlation
Crrna, by Merck Group (7 mentions)
Cas9 nuclease solution, by Thermo Fisher Scientific (4 mentions)
Cas9 protein, by Thermo Fisher Scientific (3 mentions)
Nepa21 electroporator, by Nepa Gene (3 mentions)
Genotyping primers, by Ajinomoto Group (3 mentions)
Cas9 protein solution, by Thermo Fisher Scientific (2 mentions)
Phenol red, by Merck Group (2 mentions)
Cas9 protein, by Merck Group (2 mentions)
Cas9 protein, by New England Biolabs (2 mentions)
Opti mem, by Thermo Fisher Scientific (2 mentions)
Nuclease free water, by Thermo Fisher Scientific (1 mentions)
Neon electroporation system, by Thermo Fisher Scientific (1 mentions)
Tracrrna05n 5nmol, by Merck Group (1 mentions)
Crispr rna crrna, by Merck Group (1 mentions)
Nepa21, by Nepa Gene (1 mentions)
Nanoject 2 injector, by Drummond (1 mentions)
Fast green, by Thermo Fisher Scientific (1 mentions)
Sygrna, by Merck Group (1 mentions)
Cas9 nuclease protein, by Merck Group (1 mentions)
Tracrrna, by New England Biolabs (1 mentions)
20 protocols using tracrrna
1
CRISPR-Cas9 Mediated Genome Editing
2
CRISPR-Cas9 Mediated PARP1 Knockout
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PARP1 sgRNA targeting exon 1 (5′-CGAGUCGAGUACGCCAAGAG) were designed using the BROAD GPP Web portal and purchased from Sigma. Cas9 RNP complexes were generated by incubating 200 pmol guide RNA with 200 pmol tracrRNA (Sigma) with 50 pmol SpCas9 protein (MacroLab at UC Berkeley) and then electroporated into 5 × 105 MOLM14 cells using the Invitrogen Neon electroporation system (R buffer, E2 buffer, 1050 V, 50 ms, 1 pulse). 7 days post-electroporation, cells were plated in 96 well plates at 0.5 cells/well to generate clonal cell lines. Clonal cells were harvested and analyzed by immunoblot for PARP1 protein. All experiments were conducted using 2 independent populations confirmed for PARP1 protein knockout.
3
CRISPR-Cas9 Zygote Electroporation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Superovulated B6D2F1 females were mated with B6D2F1 males, and eggs were collected from the oviduct (21 h after hCG injection). SpCas9 and SpCas9-NG were prepared as previously described7 (link) and incubated with synthesized crRNA (Sigma–Aldrich, St. Louis, MO, USA) and tracrRNA (#TRAcrRNA05N-5NMOL, Sigma–Aldrich) at 37 °C for 5 min to make a gRNA/Cas9 ribonucleoprotein complex (40 ng/µL crRNA:tracrRNA, 100 ng/µL Cas9). crRNA and tracrRNA sequence are listed in Supplementary Data 1 . The obtained complex was electroporated into zygotes using a super electroporator NEPA21 as previously described48 . The eggs were cultivated in KSOM49 (link) for 4 days until they reached to the late blastocyst stage. Blastocysts were then collected in test tubes (8–10 eggs/ tube) and incubated in lysis buffer at 37 °C for 2 h.
4
CRISPR-Cas9 Pronuclear Injection Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Pronuclear injection with 5 ng/μL of gRNA/Cas9‐expressing plasmid (for Pate1, Pate2, and Pate3) was performed as previously reported (Mashiko et al., 2013 ; Noda et al., 2017 ). The crRNA and tracrRNA (Sigma‐Aldrich, St. Louis, MO, USA) were diluted with nuclease‐free water (non‐DEPC treated, Ambion). The mixture was denatured at 95 °C for 1 min and allowed to anneal by cooling gradually to room temperature (~1 h). Each gRNA was mixed with Cas9 protein solution (Thermo Fisher Scientific, Waltham, MA, USA) and T10E0.1 buffer (10 mM Tris‐HCl, 0.1 mM EDTA, pH 7.4), and then incubated at 37 °C for 5 min to prepare the gRNA/Cas9 RNPs. For multiple gene targeting, we prepared the gRNA/Cas9 RNP solution separately and then combined them [final concentration: 30 ng/μL (≈ 200 nM) Cas9 for 20 ng/μL (≈ 600 nM) of each gRNA (Table S2 )]. After centrifugation at 20,000 g at 4 °C for 10 min, the mixture was used for pronuclear injection (for Clpsl2, Epp13, Rnase13, Gm1110, Glb1l2, and Glb1l3).
5
Generation of Zebrafish baz1b Knockout Model
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The procedure used is similar to that described by Keatinge and colleagues53 (link) but with small variations. One-cell stage zebrafish embryos were injected into the yolk with 1 nL injection solution containing 62.5 ng/μL crispr RNA (crRNA, Sigma), 62.5 ng/μL tracrRNA (Sigma, cat.tracrRNA05N), 1:8 dilution Cas9 protein (New England Biolabs, cat. M0386M; diluted in buffer B, New England Biolabs, cat. B802S) and 1:40 dilution of phenol red (Sigma Aldrich). The crRNA (5′CUCAUCCUCCACCACCCAGG) was designated to target a section of exon 5 of the zebrafish gene baz1b (ensembl gene ID: ENSDART00000158503.2) overlapping a restriction site for the Bsl1 enzyme (New England Bioscience) which includes a PAM site. Once a pair of founders was identified (outcrossing them to WT and genotyping the offspring by PCR) they were in-crossed and resulting F1 genotyped. All identified homozygous individuals (baz1b−/−) from the F1 were individually outcrossed with different non-related WT fish, eggs collected and combined to randomly select a population of heterozygous (baz1b+/−) zebrafish to constitute the F2 (minimum of two tanks of 50 individuals each). Finally, F2s were in-crossed and F3 genotyped to establish a breeding stock of fish from each genotype. Primers used for genotyping: forward 5′ AGAAGAAGAAATGGGTCATGCC and reverse 5′ CCTCTTAAACCATCTCACCTTGT.
6
Generation of Cfap97d1 Mutant Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Pronuclear injection and electroporation were performed to introduce gRNA/Cas9 RNP as previously described [20 ]. Briefly, a gRNA solution was prepared by annealing crRNA (target genome sequence: 5’-AGGTGGACTGCTGGAATGAG -3' and 5’- CTTCGACTCCCACAAAGCCT -3'; Sigma-Aldrich) and tracrRNA (Sigma-Aldrich). Then, two gRNA solutions (gRNA1 and gRNA2) and Cas9 nuclease solution (Thermo Fisher Scientific) were mixed. The final concentrations of gRNA and Cas9 were as follows: for pronuclear injection, 20 ng/μL gRNA1, 20 ng/μL gRNA2, and 54 ng/μL Cas9 nuclease; for electroporation, 20 ng/μL gRNA1, 20 ng/μL gRNA2, and 100 ng/μL Cas9 nuclease.
The gRNA/Cas9 RNPs introduced embryos (B6D2F1) were transplanted into the oviduct ampulla of pseudopregnant mice (ICR; 10 embryos per ampulla) on the following day. After 19 days, pups were delivered through Caesarean section and placed with foster mothers (ICR). To generate Cfap97d1 heterozygous mutant mice, F0 mice were mated with WT B6D2F1. Mouse colonies with a 3168 bp deletion (referred to as Cfap97d1em1) were maintained by sibling mating and used for the phenotype analysis. The genotyping primers are available inS1 Table . Frozen sperm from Cfap97d1 heterozygous mutants (B6D2-Cfap97d1 , RBRC#10805, CARD#2785) are available through RIKEN BRC (http://en.brc.riken.jp/index.shtml ) and CARD R-BASE (http://cardb.cc.kumamoto-u.ac.jp/transgenic/ ).
The gRNA/Cas9 RNPs introduced embryos (B6D2F1) were transplanted into the oviduct ampulla of pseudopregnant mice (ICR; 10 embryos per ampulla) on the following day. After 19 days, pups were delivered through Caesarean section and placed with foster mothers (ICR). To generate Cfap97d1 heterozygous mutant mice, F0 mice were mated with WT B6D2F1. Mouse colonies with a 3168 bp deletion (referred to as Cfap97d1em1) were maintained by sibling mating and used for the phenotype analysis. The genotyping primers are available in
7
CRISPR/Cas9-Mediated Genome Editing in Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Hormone-treated B6D2F1 female mice were mated with B6D2F1 males, and fertilized eggs were collected from the oviduct. Ordered crRNAs (Sigma-Aldrich) and tracrRNA (#tracrRNA05N-5NMOL, Sigma-Aldrich) were annealed, mixed with CAS9 protein (#B25640, Thermo Fisher Scientific), and then were incubated at 37 °C for 5 min to make the gRNA/Cas9 ribonucleoprotein complex (final concentration: 40 ng/μl gRNA and 100 ng/μl CAS9). The obtained complex was electroporated into fertilized eggs using a superelectroporator NEPA21 (NEPA GENE, Chiba, Japan) (poring pulse, voltage, 225 V; pulse width, 2 ms; pulse interval, 50 ms; number of pulses, +4, attenuation 10%; transfer pulse, voltage, 20 V; pulse width, 50 ms; pulse interval, 50 ms; number of pulses, ±5, attenuation 40%). The eggs were cultivated in KSOM [20 (link)] overnight, and the two-cell stage embryos were transferred into the oviducts of pseudopregnant ICR females. The pups obtained were genotyped by PCR and then subsequently confirmed by Sanger sequencing.
8
CRISPR-Cas9 Genome Editing of Autophagy Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The online web tool CHOPCHOP was used to design a specific guide RNA in exon 3 of atg5 and exon 2 atg16l1. Purified crRNA, Cas9 protein, and tracrRNA were purchased from Sigma-Aldrich. We used the following crRNA sequences, where the PAM site is indicated in brackets: atg5: TCAGGTAACTGACCCGTGGG(AGG) atg16l1: TTTGTGGAAGCGTCACGTTG(TGG). Each embryo was injected with 1 nl of 16.6 µM crRNA, tracrRNA, and Cas9 protein mixture at the one-cell stage. As controls, only Cas9 + tracrRNA were without crRNA.
9
Targeted Genome Editing of ptges in Zebrafish
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The online web tool CHOPCHOP was used to design a specific gRNA spanning the ATG of ptges. Purified gRNA, Cas9 protein, and tracrRNA were purchased from Sigma-Aldrich. The ptges guide sequence is gauagaggcucaagaugcucguuuuagagcuaugcuguuuug, targeting sequence gatagaggctcaagatgctcggg of the gene. Each embryo was injected with 1 nl of 6.6 nM gRNA, tracrRNA, and Cas9 protein at the one-cell stage. Genomic DNA was extracted from injected larvae, and PCR amplification was performed, generating a 345-bp product spanning the ATG of the ptges gene (ENSDARG00000020136). Primers used were ptges guide F1 gccaagtataatgaggaatggg and ptges guide R1 aatgtttggattaaacgcgact. Genotype was determined by digestion with MwoI. Wild-type PCR products produce 184-, 109-, and 52-bp bands. Mutant forms produce 293- and 52-bp bands.
10
CRISPR/Cas9-Mediated Cyp11c1 Mutagenesis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Mutation of cyp11c1 was achieved using the SygRNA system (Sigma). A crRNA was designed to target exon 2 of cyp11c1 (ENSDART00000185978.1). Approximately 1 nL of a 4 µL mixture containing 0.1 µM crRNA, 0.1 µM tracrRNA (Sigma), 1 µL phenol red and 1 µL Cas9 (NEB, Ipswich, Massachusetts, USA) was injected into 1-cell stage embryos. The Cas9 cut site overlapped a BslI restriction site, allowing screening for mutant alleles lacking sensitivity to BslI (Supplementary Fig. 1, see section on supplementary materials given at the end of this article). CRISPR/Cas9-injected embryos were raised and outcrossed to unrelated WT fish. The resulting progeny were screened for disruption of cyp11c1, and out-of-frame mutations were identified by DNA sequencing.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!