Rna stat 60

Real time PCR was carried out as previously described [7 (link)]. Briefly, left lungs were pulverized over dry ice and 100 mg of tissue lysed in 1 ml RNA STAT-60 (AMS Biotechnology) to extract total RNA. 1 μg of total RNA was used as a template for random-primed reverse transcription using an iScript cDNA synthesis kit (Bio-Rad). Real time PCR analysis was performed using iTaq SYBR Green supermix with ROX (Bio-Rad) in an ABI 7500 multi-color real time PCR detection system (Applied Biosystems). PCR primers for MKL2 (also known as MRTFB) were CCCCAGCAGTTTGTTGTTCAGCACTCTT (forward) and GATGCTGGCTGTCACTGGTTTCATCTTG (reverse), for α-SMA were AAACAGGAATACGACGAAG (forward) and CAGGAATGATTTGGAAAGGA (reverse), for FN were AGACCATACCTGCCGAATGTAG (forward) and GAGAGCTTCCTGTCCTGTAGAG (reverse), and for Collagen 1α1 were ATGTTCAGCTTTGTGGACCT (forward) and CAGCTGACTTCAGGGATGT (reverse).

Total RNA was prepared from ∼30 mg of snap frozen liver with RNA STAT-60 (Amsbio) reagent according to the manufacturer’s instructions. DNase digestion was performed on-column with an RNAeasy Kit (Qiagen) according to manufacturer’s instructions. RNA concentration was estimated with a NanoDrop (Thermo Fisher). For RNA-seq, equal masses of RNA (2.5 μg) from mice of the same genotype were pooled to create one sample per genotype. Library preparation was completed with an Illumina TruSeq Stranded Total RNA kit. Samples were analyzed on a HiSeq 2500 (Illumina) machine in Rapid Run mode with paired-end 100 bp × 100 bp sequencing. CASAVA 1.8.2 (Illumina) was used to convert BCL files to FASTQ files. Default parameters were used. Rsem-1.2.09 was used for running the alignments as well as generating gene and transcript expression levels. The “rsem-calculate-expression” module was used with the following options: “bowtie-chunkmbs 200,” “calc-ci,” “output-genome-bam,” “paired-end,” and “forward-prob.” The data were aligned to the M. musculus mm10 reference genome. The “rsem-run-ebseq” and “rsem-control-fdr” scripts provided by Rsem were used to run EBSeq to perform differential expression analysis. All default parameters were used, except “FDR_rate” was set to 0.05.

Total RNA preparation from S. pombe and RT-qPCR analysis have been described previously (Shao and Espenshade, 2014 (link)). Briefly, total RNA was isolated using RNA STAT-60 (amsbio, Cambridge, MA). cDNA was synthesized using oligo d(T)₂₃VN primers (NEB). The tested genes were quantified by real-time PCR using SYBR Green qPCR master mix (Promega). tub1⁺ served as the internal control to calculate the relative expression across different samples. Error bars represent ± SEM of fold changes from three biological replicates.

Total RNA was isolated from CHO derived cells by acid guanidinium thiocyanate-phenol-chloroform extraction using RNA STAT 60 (Amsbio) and isopropanol precipitation. 1.5 μg of RNA was reverse transcribed by a reverse transcriptase RevertAid (ThermoFisher) with oligo(dT)18 primer. Quantitative PCR analysis was performed using Power SYBR Green PCR Master Mix (Applied Biosystems) according the manufacturer’s instruction on a 7900HT Fast Real-Time PCR system (Applied Biosystems). Oligo DNAs in Tabel I were used for PCR reaction; No. 19 and No. 20 for EIF2B4, No. 21 and No. 22 for EIF2B1, No. 23 and No. 24 for RPL27. Relative quantities of amplified PCR products were determined using SDS 2.4.1 software (Applied Biosystems) and normalized to RPL27 values.

Isolation of RNA from cell lines was performed using phenol-based RNA STAT-60^™ (Amsbio, Abingdon, UK) according to manufacturer's instructions. RNA was reverse transcribed using the Transcriptor First Strand cDNA Synthesis Kit (Roche, Burgess Hill, UK) according to manufacturer's directions. Quantitative real-time PCR (qPCR) was carried out on the LightCycler^® 480 (Roche) using Light Cycler^® 480 SYBR Green I Master kit (Roche) following manufacturer's recommendations. qPCR primer sequences are listed in Supplementary Table S1.