Fastpure cell total rna isolation kit

Total RNA was extracted using the FastPure® Cell Total RNA Isolation Kit (Vazyme, Nanjing, China) and dissolved in RNase-free water. RNA samples were quantified by measuring the OD value at 260 nm, and the OD 260/280 ratios for all RNA samples fell within the range of 1.8 to 2.1. Reverse transcription was performed using the HiScript III RT SuperMix for qPCR (+gDNA wiper) kit (Vazyme), following the manufacturer’s instructions. RT-qPCR was conducted using the ChamQ Universal SYBR qPCR Master Mix kit (Vazyme), and the PCR mixture was run in the CFX96 Real-Time PCR system (Bio-Rad, USA). Three technical replicates were set and expression levels were normalized to the expression of GAPDH. Relative expression levels compared to the control group were determined by calculating the 2 - ^ΔΔCt.

According to the manufacturer’s instructions, total RNA was isolated from postinfected and noninfected cells using the FastPure® Cell Total RNA isolation kit (RC112-01, Vazyme Biotech Co., Ltd., China). RNA was reverse transcribed to cDNA with the First Strand cDNA Synthesis Kit (Cat No. 11,119–11,141; Yeasen, Shanghai, China), and reverse transcription PCR (RT‒PCR) was performed. The total volume of the reaction was 10 µL, and the thermocycler program was as follows: 94 °C for 10 min and 40 cycles of 94 °C for 20 s, 58 °C for 20 s, and 72 °C for 20 s. The relative mRNA levels were calculated using the 2 − ΔΔCt method [24 (link)]. GAPDH was used as an internal control.

Total RNA was extracted using FastPure Cell Total RNA Isolation Kit (Vazyme, Nanjing, China) and reverse transcribed into cDNA with PrimeScript RT reagent kit (Takara, Kyoto, Japan). The cDNA amplification and detection were performed using SYBR Premix Ex Taq Kit (TaKaRa) according to the manufacturer's introduction. The primer sequences were as follows: Gapdh forward: AGGTCGGTGTGAACGGATTTG, reverse: GGGGTCGTTGATGGCAACA; Cebpb forward: CTGAGCGACGAGTACAAGAT, reverse: CTTGAACAAGTTCCGCAGG; Runx2 forward: CCTTCAAGGTTGTAGCCCTC, reverse: GGAGTAGTTCTCATCATTCCCG; Sp7 forward: GGAAAGGAGGCACAAAGAAGC, reverse: CCCCTTAGGCACTAGGAGC; Bglap2 forward: CTGACCTCACAGATCCCAAGC, reverse: TGGTCTGATAGCTCGTCACAAG. Then, the relative gene expression was normalized to the internal control (GAPDH) and analyzed with the 2^−ΔΔCt method.

The total RNA of the above cells was isolated using the Fast Pure Cell Total RNA Isolation Kit (Vazyme, RC101-01). Then, reverse transcription was conducted with the HiScript III RT SuperMix for qPCR (+gDNA wiper) Kit (Vazyme, R323-01). Next, RT-qPCR was performed in triplicate with ChamQ Universal SYBR qPCR Master Mix (Vazyme, Q711). The mRNA expression level of B4GALNT, FAM83D, COL1A1, CHRM3, and MYBPC1 was normalized by β-actin mRNA. All experiments were conducted following the manufacturer’s protocol. The primer sequences are listed in Table S3.

Human gastric cancer cell lines (HGC-27 and MKN-45) and a human gastric mucosal epithelial cell line (GES-1) were obtained from Cell Bank, Institute of Life Sciences, Chinese Academy of Sciences Cell Bank (Shanghai, China). The HGC-27 and GES-1 cells were cultured in DMEM medium (Gibco, Grand Island, America), while MKN-45 cells were cultured in RPMI 1640 medium (Gibco, Grand Island, America), with both media supplemented with 10% fetal bovine serum (Gibco, Grand Island, America). The cells were incubated in a humidified atmosphere at 37 °C with 5% CO₂. Total cellular RNA was extracted using the FastPure cell Total RNA Isolation Kit (Vazyme, Nanjing, China) and quantified by NanoDrop Lite spectrophotometer (Thermo Scientific). For cDNA synthesis, the total RNA underwent reverse transcription using the HiScript II Q RT SuperMix for QPCR (Quantitative real time polymerase chain reaction, Vazyme, Nanjing, China) according to the manufacturer’s instruction. QPCR was performed in triplicate on the Applied Biosystems StepOnePlus QPCR System (Thermo Fisher Scientific) using the T aq Pro Universal SYBR QPCR Master Mix (Vazyme, Nanjing, China). The relative RNA expression levels were determined, with GAPDH used as an internal control. The relative expression of each RNA was calculated using the 2^−∆∆Ct. The primers sequences were listed in Table S1.