Lenticrispr v2 hygro

ORAI1 (gRNA #1: GATCGGCCAGAGTTACTCCG, gRNA #2: CGGCGAAGACGATAAAGATC) gRNAs were inserted into lentiCRISPRv2-hygro (gift from Brett Stringer, Addgene plasmid # 98291). AdTRACK-CMV-hORAI1 (gift from Gregory J. Barritt) was used as a PCR template to amplify ORAI1. ECFP-ORAI1-L273D (gift from Donald L. Gill) was used as a PCR template to amplify ORAI1L273D. ORAI1-myc E106Q MO70 (gift from Anjana Rao, Addgene # 22754) was used as a PCR template to amplify ORAI1E106Q. HA-NFAT1(4-460)-GFP (gift from Anjana Rao, Addgene # 11107) was used as a PCR template to amplify NFAT1(4-460)-GFP. All PCR products were cloned into pcDH-EF1-FHC (gift from Richard Wood, Addgene plasmid # 64874) using a strong Kozak sequence (GCC ACC) in front of the starting ATG. To generate ORAI1 cDNA insensitive to CRISPR-Cas9, silent mutations (changing the DNA base pair but keeping the amino acid sequence identical) were introduced on ORAI1 cDNA PAM sequence sites by PCR-driven overlap extension.

pTRIPZ inducible human STAG2 shRNA (shSTAG2#60) has been described previously^{6 (link)}. For shSTAG2#60 resistant STAG2 mutant, the mutated STAG2 allele was generated using PCR mutagenesis and verified by sequencing. pLKO construct containing shRNAs against human STAG1(shSTAG1#197: TRCN0000145197) was purchased from Sigma and described previously^{6 (link)}. LentiCRISPR v2 (#52961), LentiCRISPR v2 hygro (#98291), psPAX2 (#12260), and pCMV-VSV-G (#8454) were purchased from Addgene. LCV2-KRAB-dCas9-BSD was previously described^{21 (link)}.

MyC-CaP (ATCC, Manassas, VA, USA) and RAW264.7 (RAW) (National Collection of Authenticated Cell Cultures at Shanghai, China) were cultured in DMEM media supplemented with 10% charcoal stripped fetal bovine serum (FBS), which mimics the low-androgen condition in castration-resistant prostate cancer, and 1× Penicillin–Streptomycin. PC-3 (National Collection of Authenticated Cell Cultures at Shanghai, China) and C4-2 (ATCC, Manassas, VA, USA) were cultured in RPMI 1640 media supplemented with 10% FBS and 1× Penicillin–Streptomycin. All cells were cultured in 37 °C, 5% CO₂ humidified cell incubators. Pexidartinib was purchased from Selleck (Cat#S7818, Shanghai, China). The overexpression plasmid of murine CXCL12 was developed through Gibson assembly of the PCR product from the forward primer 5′-CGCCAGAACACAGGACCGGTTCTAGAATGGACGCCAAGGTCGTC-3′ and the reverse primer 5′-CATCGTCTTTGTAATCCATCTCGAGCTTGTTTAAAGCTTTCTCCAGGTAC-3′, and the double digested plasmid lentiCRISPRv2 hygro from Addgene (Cat#98291, Watertown, MA, USA) was developed with Gibson assembly mastermix (Cat#E2611S, NEB Biolabs, Ipswich, MA, USA). The ELISA kit used to examine the CXCL12 from RAW cells was purchased from R&D Systems (Cat#MCX120, Minneapolis, MN, USA), and ELISA was undertaken in accordance with the manufacturer’s protocol.

Guide RNA (gRNA) targeting IRF9 (GAACTGTGCTGTCGCTTTGA) was designed on the website http://crispor.tefor.net/. gRNA targeting human rosa26 (AGGCCGCACCCTTCTCCGG) was used as a control. Sense and antisense oligonucleotides were annealed and then cloned into lentiCRISPR v2 hygro (Addgene #98291) according to the “Target Guide Sequence Cloning Protocol” Provided by the laboratory of Dr. Feng Zhang^{56 (link)}.

CRISPR/Cas9 targets for rat gene Chga and Chgb were selected and designed based on the ChopChop algorithm to introduce double-stranded breaks and non-homologous end joinings into the genes. A pair of oligos for Chga target were cloned into lentiCRISPRv2 hygro and lentiCRISPRv2 blast (plasmid #98291 and #98293; Addgene), respectively, and a pair of oligos for Chgb target were cloned into LentiCRISPRv2-mCherry (plasmid #99154; Addgene) and lentiviruses were generated according to Zhang lab GeCKO website (http://genome-engineering.org/gecko/) information. INS1 832/13 cells were infected by lentiviruses conferring the gRNAs targeting Chga and selected with 400 μg/ml hygromycin and 10 μg/ml blasticidin sequentially. Positive knockout clones were confirmed by western blotting and qRT-PCR and expanded. INS1 832/13 Chga-KO cells were then infected by lentiviruses conferring both gRNAs targeting Chgb and single clones of mCherry-positive cells were picked out for further validation of positive knockout clones.

The CAGA9-Lux gene reporter construct was previously described (Seo et al., 2006 (link)). The expression vector pcDNA3.1-Prdm16 was a gift from Dr. Bruce Spiegelman (#15503; Addgene). The expression vector pCMV5-HA-Smad4 was a gift from Dr. Joan Massague. To generate the Prdm16-Lux reporter, genomic fragments (1,391 bp) upstream of the transcription initiation site (SST) of the PRDM16 gene (based on gene association NM_022114 and Eukaryotic Promoter Database, epd.epfl.ch) was amplified by the Genomic-GC PCR amplification kit (BD Biosciences) using human genomic DNA obtained from PANC-1 cells. Unique KpnI and XhoI sites were incorporated at the 5′ and 3′ ends of the sequence, respectively, to simplify directional cloning into KpnI and XhoI sites in the reporter plasmid, pGL3-basic (Promega). Introduction of inactivating mutation into the SBE sequence (−41 bp from SST) was generated by PCR using the QuickChange Site-Directed Mutagenesis kit according to the manufacturer’s instructions (Stratagene). The lentiCRISPRV2 expression vectors encoding SMAD4 and PRDM16 gRNAs were purchased from GenScript. The lentiCRISPRV2 expression vectors encoding SMAD2 and SMAD3 gRNAs were generated using lentiCRISPRV2 hygro (#98291; Addgene) and primers with sequences generated using the Synthego Design tool. All cloned cDNAs and their corresponding mutants were checked by sequencing.

pB-tetO-L1-G418^R/blast, pEAK8-FANCD2-YFP, pEAK8-FANCD2(K561R)-YFP, pJJ101/L1.3, pJJ101/L1.3(D702A) and pCEP/GFP were previously published and characterized^{13 (link),49 (link)}. pB-tetO-L1(D205A)-G418^R/blast reporter was generated by mutagenesis from pB-tetO-L1-G418^R/blast with Q5 Site-Directed Mutagenesis Kit Protocol (E0554; New England Laboratories). SLX4 (1–1,834) and truncation ‘mini-SLX4’ (1–750) cDNA sequences were amplified by PCR from genomic DNA and cloned into pcDNA 3.1/Zeo(+). XPF and XPF(D175A) cDNA were previously published^{56 (link)}. XPF and XPF(D175A) were amplified by PCR from original plasmids and cloned into pLenti-CMV-GFP-Hygro (Addgene catalog no. 17446), where GFP was exchanged for the cDNA by Gibson assembly. FANCA and FANCC cDNAs were PCR amplified and cloned into pLenti-CMV-GFP-Hygro (Addgene catalog no. 17446), where GFP was exchanged for the cDNA by Gibson assembly. All single-guide RNAs used to generate the DNA repair genetic knockouts in K562 were cloned into pKLV2-U6gRNA5(BbsI)-PGKpuro2AmCherry-W (Addgene catalog no. 67977) or lentiGuide-Hygro-eGFP (Addgene catalog no. 99375). For constitutive Cas9 expression in K562 L1(D205A)-G418^R line, K562 cells were nucleofected with lentiCRISPRv2-hygro (Addgene catalog no. 98291).