Lightcycler 480 sybr green master mix

Manufactured by Takara Bio

Sourced in China

The LightCycler 480 SYBR Green Master Mix is a ready-to-use solution for real-time PCR analysis. It contains all the necessary components, including SYBR Green I dye, for the detection and quantification of DNA targets.

Automatically generated - may contain errors

Lab products found in correlation

Rnaprep pure plant kit, by Transgene (2 mentions) Superscript 3 transcriptase, by Thermo Fisher Scientific (2 mentions) Cfx96, by Bio-Rad (2 mentions) Reverse transcription kit, by Takara Bio (1 mentions) Primescript rt reagent kit, by Takara Bio (1 mentions)

Close spelling variants of this product

SYBR Green (1328 citations) SYBR Green Mix (330 citations) SYBR Master Mix (112 citations) LightCycler 480 (52 citations) LightCycler (12 citations)

6 protocols using lightcycler 480 sybr green master mix

Quantitative Assessment of Chondrogenic and Inflammatory Markers

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total cellular RNA was extracted using an RNA extraction Kit (Omega) and then reverse-transcripted into cDNA using an EVO-MLV RT Kit (Accurate Biotechnology). LightCycler 480 SYBR Green Master Mix (TaKaRa) was used for qRT-PCR analysis. The endogenous control used the reference gene GAPDH. The relative gene expression was measured by the 2-ΔΔCt method. Three independent experiments were performed. The primers sequences in this study are listed in Table 1.Table 1

Primer sequences of each gene.

Table 1

Target	Forward		Reverse
COL-2	AACCCAAAGGACCCAAATAC		CCGGACTGTGAGGTTAGGAT
SOX-9	CGTGGTGACAAGGGTGAGAC		TAGGTGATGTTCTGGGAGGC
MMP-13	AGGCCTTCAGAAAAGCCTTC		GAGCTGCTTGTCCAGGTTTC
Arg-1	CTCCAAGCCAAAGTCCTTAGAG		GGAGCTGTCATTAGGGACATCA
IL-10	CTTACTGACTGGCATGAGGATCA	GCAGCTCTAGGAGCATGTGG
iNOS	GTTCTCAGCCCAACAATACAAGA	GTGGACGGGTCGATGTCAC
TNF-α	CGAGTGACAAGCCTGTAGCC	ACAAGGTACAACCCATCGGC
GAPDH	AGCCCAGAACATCATCCCTG	CACCACCTTCTTGATGTCATC

Guan P., Liu C., Xie D., Mao S., Ji Y., Lin Y., Chen Z., Wang Q., Fan L, & Sun Y. (2021). Exosome-loaded extracellular matrix-mimic hydrogel with anti-inflammatory property Facilitates/promotes growth plate injury repair. Bioactive Materials, 10, 145-158.

+ Open protocol

+ Expand

Transcriptional Profiling of PtrDBB Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

A heatmap was created using TBtools to exhibit the expression patterns of PtrDBBs. RNAseq data of PtrDBB genes in 14 tissues were collected according to Rodgers-Melnick et al. [51 (link)]. The NCBI Primer-BLAST tool was used to design the primers of the 12 PtrDBB genes, which could amplify the 100–200 bp PCR products (Additional file: Table S4). Total RNA was isolated from the samples of each tissue using an RNAprep Pure Plant Kit (TransGen Biotech, Beijing, China) according to the user manual. Total RNAs were used for complementary cDNA synthesis using SuperScript III transcriptase (Invitrogen, Carlsbad, CA, USA) in accordance with the manufacturer’s instructions. qRT-PCR analysis was performed on a Bio-Rad CFX96 using the Light Cycler 480 SYBR Green Master Mix (TaKaRa, Dalian, China). The PCR reaction conditions were as follows: 95 °C for 30 s, followed by 40 cycles of 95 °C for 5 s, and 60 °C for 30 s. The quantitative RT-PCR data were analyzed using the 2^−ΔΔCt method. The mean expression values and SE values were calculated from the results of three independent experiments.

Wu R., Li Y., Wang L., Li Z., Wu R., Xu K, & Liu Y. (2024). The DBB Family in Populus trichocarpa: Identification, Characterization, Evolution and Expression Profiles. Molecules, 29(8), 1823.

+ Open protocol

+ Expand

Quantitative Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

The total RNA was harvested using a total RNA kit (Omega, USA) and then reverse-transcribed into cDNA by a reverse transcription kit (Takara, Japan). Real-time qPCR (RT-qPCR) was conducted using the LightCycler 480 SYBR Green Master Mix (Takara, Japan). This experiment was repeated in triplicates followed by calculating with the 2 –ΔΔCt method. Table 1 displayed the primers used in the present study.Table 1

Primer sequences of each gene.

Table 1

Target	Forward	Reverse
GAPDH	AGACAGCCGCATCTTCTTGT	CTTGCCGTGGGTAGAGTCAT
NF	GTTCCGAGTGAGGTTGGACC	CCGCCGGTACTCAGTTATCTC
GAP43	GCACATCGGCTTGTTTAGGCT	GGAGGGAGATGGCTCTGCTACT
TUJ1	CCCGTTTTAGCCACCTTTGTATT	CCCTCCAAATATAAACACAACCC
SYN	CTTCCTGGTTGGGGACTACTCCTC	GCGAACACGGCTGTAGCCAGAAAG
Arg-1	CTCCAAGCCAAAGTCCTTAGAG	GGAGCTGTCATTAGGGACATCA
IL-10	CTTACTGACTGGCATGAGGATCA	GCAGCTCTAGGAGCATGTGG
iNOS	GTTCTCAGCCCAACAATACAAGA	GTGGACGGGTCGATGTCAC
TNF-α	CGAGTGACAAGCCTGTAGCC	ACAAGGTACAACCCATCGGC

Yang Q., Su S., Liu S., Yang S., Xu J., Zhong Y., Yang Y., Tian L., Tan Z., Wang J., Yu Z., Shi Z, & Liang F. (2023). Exosomes-loaded electroconductive nerve dressing for nerve regeneration and pain relief against diabetic peripheral nerve injury. Bioactive Materials, 26, 194-215.

+ Open protocol

+ Expand

Comprehensive qRT-PCR Analysis of PeUBP Genes

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

The qRT-PCR was performed using 48 genes based on their similarity levels to the reference genes in the phylogenetic tree. The primers of qRT-PCR of the 48 PeUBP genes are listed in Table S4. Total RNA was isolated from samples of each tissue using an RNAprep Pure Plant Kit (TransGen Biotech, Beijing, China) according to the user manual. Total RNAs were used for complementary cDNA synthesis using SuperScript III transcriptase (Invitrogen, Carlsbad, American) in accordance with the manufacturer’s instructions [61 (link)]. The qRT-PCR analysis was performed on a Bio-Rad CFX96 using the Light Cycler 480 SYBR Green Master Mix (TaKaRa, Dalian, China). The PCR reaction conditions were as follows: 95 °C for 30 s, followed by 40 cycles of 95 °C for 5 s, and 60 °C for 30 s. The expression values of the individual genes were normalized using the expression level of TIP41 as an internal standard [60 (link)]. The mean expression values and SE values were calculated from the results of three independent experiments.

Wu R., Shi Y., Zhang Q., Zheng W., Chen S., Du L, & Lu C. (2019). Genome-Wide Identification and Characterization of the UBP Gene Family in Moso Bamboo (Phyllostachys edulis). International Journal of Molecular Sciences, 20(17), 4309.

+ Open protocol

+ Expand

Quantitative Real-Time PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

The total RNA was extracted by using the mRNA extraction kit (Omega) and then reverse transcribed into cDNA using the PrimeScript TM RT reagent kit (TaKaRa). The qRT-PCR analysis was performed by using the LightCycler 480 SYBR Green Master Mix (TaKaRa). The primers used in this study are provided in Table 2. The gene expression was calculated using the 2-ΔΔCt method.

Liu C., Fan L., Tian Z., Wen H., Zhou L., Guan P., Luo Y., Chan C., Tan G., Ning C., Rong L, & Liu B. (2021). Self-curling electroconductive nerve dressing for enhancing peripheral nerve regeneration in diabetic rats. Bioactive Materials, 6(11), 3892-3903.

+ Open protocol

+ Expand

RNA Extraction and qRT-PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

An RNA extraction kit (Omega) was used to extract total RNA, which was subsequently reverse transcribed into cDNA using the EVO-MLV RT kit (Accurate Biotechnology). LightCycler 480 SYBR Green Master Mix (TaKaRa) was used for the qRT-PCR analysis. The relative standard curve method (2-△△CT) was used to determine mRNA expression. Table 1 shows the primer sequences.

Cheng J., Rong G., Wang Z., Liu S., Yang Q., Liu W., Zhang D, & Li J. (2022). ECM-Mimicking Hydrogels Loaded with Bone Mesenchymal Stem Cell-Derived Exosomes for the Treatment of Cartilage Defects. Evidence-based Complementary and Alternative Medicine : eCAM, 2022, 3450672.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!