All chemicals were obtained commercially and used without additional purification. Human serum albumin (HSA), glutaraldehyde (GA), D,L-Sulforaphane (≥90%, HPLC), polyethyleneimine (PEI) with average Mw = 25,000 (all from Sigma-Aldrich), plasmid pF141 pAcGFP1 SOD1WT (Addgene, https://www.addgene.org/26402/ ), absolute ethanol (ET0016, 99.99%; Scharlau Chemie, Spain), phosphate buffer saline (PBS) and dimethyl sulfoxide (DMSO) (Reachim, Russia), and MilliQ water (18 mΩ×cm; Millipore). 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT), Dulbecco’s Modified Eagle Medium (DMEM), and the 2',7'- dichlorofluorescein diacetate (DCFH-DA) dye. Commercial SOD assay kits were ordered from Sigma Aldrich. Hydrogen peroxide (30%) was purchased from Merck. Other chemicals used in the current study were of analytical and molecular biology grades. L-132 (Human Lung epithelial cells) cell line was obtained from National Centre for Cell Science, Pune, India. They were maintained in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% calf serum and 1% Penicillin-streptomycin maintained in a 37°C incubator with 5% CO2 and 95% air.
Polyethyleneimine pei
Manufactured by Merck Group
Sourced in United States, Germany
Polyethyleneimine (PEI) is a cationic polymer used as a transfection agent in cell culture and molecular biology applications. It facilitates the uptake of nucleic acids, such as DNA and RNA, into cells. PEI is known for its ability to form stable complexes with genetic material, which can then be delivered into cells.
Automatically generated - may contain errors
Lab products found in correlation
Fetal bovine serum (fbs), by Thermo Fisher Scientific (7 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (5 mentions)
Hek293 cell, by American Type Culture Collection (4 mentions)
Trypsin edta, by Thermo Fisher Scientific (4 mentions)
Chitosan, by Merck Group (3 mentions)
Penicillin streptomycin, by Thermo Fisher Scientific (3 mentions)
Exoquick tc, by System Biosciences (3 mentions)
Lipofectamine 2000 reagent, by Thermo Fisher Scientific (3 mentions)
Acetone, by Avantor (2 mentions)
Nicotine hydrogen tartrate, by Merck Group (2 mentions)
125i epibatidine, by PerkinElmer (2 mentions)
2 2 bromoacetyloxy n n n trimethylethanaminium bromide, by Merck Group (2 mentions)
1 4 dithio dl treithol, by Merck Group (2 mentions)
Neurobasal media, by Thermo Fisher Scientific (2 mentions)
4 2 hydroxyethyl piperazineethanesulfonic acid hepes half sodium salt, by Roche (2 mentions)
Polybrene, by Merck Group (2 mentions)
Penicillin streptomycin, by Merck Group (2 mentions)
Laminin, by Merck Group (2 mentions)
Hoechst 33342, by Thermo Fisher Scientific (2 mentions)
Lipofectamine rnaimax, by Thermo Fisher Scientific (2 mentions)
59 protocols using polyethyleneimine pei
1
Antioxidant Evaluation of Sulforaphane Nanoparticles
2
Peptide-Mediated Gene Delivery System
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All of the peptides were
custom-synthesized with >95% purity grade from G.L. Biochem (Shanghai)
Ltd. The plasmid used for this study, pMIR-REPORT Luciferase (pDNA),
was maintained in E. coli DH5α
cells and purified using GenElute HP Endotoxin-Free Plasmid MaxiPrep
Kit (Sigma). Polyethyleneimine (PEI, MW ∼ 25 kDa, branched)
was purchased from Sigma-Aldrich. Lipofectamine 2000, heparin salt
was purchased from Invitrogen. Primers for q-PCR were designed using
Primer3 Input version 0.4.0 and synthesized through (Integrated DNA
Technologies) IDT (Supporting InformationTable S1 ). Fluorescein DNA labeling kits were purchased from Mirus
Bio Corporation. Cell viability assay kit CellTiter Glow was obtained
from Promega, and 35 mm glass-bottom imaging dishes for confocal microscopy
were purchased from ibidi cells in focus. KAPA SYBR fast 5× was
purchased from Sigma-Aldrich. Dulbecco’s modified Eagle’s
medium (DMEM) culture medium, phosphate-buffered saline (PBS), calf
fetal serum, and penicillin/streptomycin antibiotics mixture were
purchased from Invitrogen.
custom-synthesized with >95% purity grade from G.L. Biochem (Shanghai)
Ltd. The plasmid used for this study, pMIR-REPORT Luciferase (pDNA),
was maintained in E. coli DH5α
cells and purified using GenElute HP Endotoxin-Free Plasmid MaxiPrep
Kit (Sigma). Polyethyleneimine (PEI, MW ∼ 25 kDa, branched)
was purchased from Sigma-Aldrich. Lipofectamine 2000, heparin salt
was purchased from Invitrogen. Primers for q-PCR were designed using
Primer3 Input version 0.4.0 and synthesized through (Integrated DNA
Technologies) IDT (Supporting Information
Bio Corporation. Cell viability assay kit CellTiter Glow was obtained
from Promega, and 35 mm glass-bottom imaging dishes for confocal microscopy
were purchased from ibidi cells in focus. KAPA SYBR fast 5× was
purchased from Sigma-Aldrich. Dulbecco’s modified Eagle’s
medium (DMEM) culture medium, phosphate-buffered saline (PBS), calf
fetal serum, and penicillin/streptomycin antibiotics mixture were
purchased from Invitrogen.
3
Deflocculation of Ethanol Yeast by Papain
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Samples of flocculated Saccharomyces cerevisiae from fuel ethanol distillery (Raizen, Maracaí, SP, Brazil) were used in deflocculation test with commercial crude papain (Vetec Química Fina LTDA, EC 3.4.22.2) with 6000 U·mg−1 of proteolytic activity. This enzyme was dissolved in phosphate buffer 0.2 mol·L−1, pH 6.4. The PA (pure for analysis) reagents used for enzyme immobilization were 25% glutaraldehyde in water, polyethyleneimine (PEI) of high molecular weight (Sigma-Aldrich Co.), and sodium tripolyphosphate (TPP) (Na5P3O10). Chitin was extracted from shrimp shells and high molecular weight chitosan was obtained from Aldrich (code 419419-50 G). The proteolytic activity of papain was determined by hydrolysis of sulfanilamide azocasein [27 (link)], and total protein was determined by Bradford [28 (link)].
4
Multifunctional Polymer-Based Antimicrobial Formulations
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Poly(acrylic acid) (molecular weight (Mw = 100 kDa) (PAA), trimethylamine (TMA), alginic acid sodium salt of medium viscosity (ALG), polyethylene imine (PEI) (Mw = 600–1000 kDa), poly(allylamine hydrochloride) (PAH) (Mw = 450 kDa), Span 80, Tween 80 and D2O (99.9% at D) were purchased from Sigma-Aldrich (Poznań, Poland). 12-bromododecan-1-ol (purity 99.13%) and 6-bromohexan-1-ol (purity 97.67%) were obtained from BLD Pharmatech Ltd. (Shanghai, China). N,N′-dicyclohexylcarbodiimide (DCC), 4-dimethylaminopyridine (DMAP) and chitosan (CHIT) (Mw = 100–300 kDa) were all synthetic grade and purchased from Acros Organics (Geel, Belgium). Curcumin (CUR) was obtained from Archem Sp. z o.o. (Kamieniec Wrocławski, Poland). Nutrient broth and Mueller-Hinton agar were purchased from Biocorp Polska Sp. z o.o. (Warszawa, Poland). Methanol and acetic acid were analytical grade and purchased from P.P.H.’ STANLAB’ Sp. J. (Lublin, Poland). Calcium chloride, dimethylsulfoxide (DMSO), hexane, and acetone (all chemicals of analytical grade) were obtained from Avantor Performance Materials (Gliwice, Poland).
5
Bacterial Expression Vector Preparation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Example 1
The pET-21a vector and BL21 (DE3) E. coli cells were obtained from Novagen Inc. (Madison, Wisconsin, US). Top10 competent cells were obtained from Invitrogen (Carlsbad, California, US). Oligonucleotides were synthesized chemically at Cosmo Gene Tech (Seoul, South Korea). The FastAP thermosensitive alkaline phosphatase and restriction endonuclease including BamHI and XbaI were purchased from Fermentas (Ontario, Canada). Other restriction endonuclease including BseRI and AcuI and all other restriction enzymes were obtained from New England Biolabs (Ipswich, Massachusetts, US). DNA miniprep, gel extraction and PCR purification kits were obtained from Geneall Biotechnology (Seoul, South Korea). Dyne Agarose High was obtained from Dyne Bio, Inc. (Seongnam, South Korea). All the Top10 cells were grown in TB DRY media obtained from MO Bio Laboratories, Inc. (Carlsbad. California, US). All the BL21 (DE3) cells were grown in CircleGrow media obtained from MP Biomedicals (Solon, Ohio, US). Ready Gel (Tris-HCl 2-20%) as a precast gel was purchased from Bio-Rad (Hercules, California, US). Phosphate-buffered saline (PBS, pH 7.4), ampicillin and polyethyleneimine (PEI) were obtained from Sigma-Aldrich (St Louis, Missouri).
6
SPARCL1 Activation and Inhibition Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
SPARCL1 activation (VPR-S) and inhibitory vectors (dCas9-S) were constructed by Liu et al. [8 (link)] (SPARCL1 is also named as ECM2, thus the effective ECM2 vectors constructed by Liu et al. were used for SPARCL1 activation or inhibition in this study). ZiFiT online software was used to predict SPARCL1 (ECM2) promoter target site (ID: 533916). The fragment “GTCTTTGTTACTATGTGCGG” reported by Liu et al. was synthesized, annealed, and ligated into the BbsI site of the pSPgRNA expression vector. This recombinant plasmid was co-transfected into cells combined with dCas9-VPR or dCas9 plasmid vector to activate or inhibit SPARCL1 expression. Polyethyleneimine (PEI, Sigma, St. Louis, MO, USA) was used for CRISPR transfection. The PEI transfection method was described by Pang et al. [15 (link)]. siRNA transfection was performed using LIP2000 according to the manufacturer’s protocol.
7
Neurobasal Media Preparation and Reagents for Cell Culture
8
Isolation and Culture of Neonatal Mouse Microglia
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Microglial cultures were prepared from the brains of postnatal day 1
mouse pups, as previously described (Sepulveda‐Diaz et al.,2016 ). Whole brains were harvested,
the meninges were stripped away and brain tissue pieces were placed in 4 ml of
Leibovitz's L‐15 medium (Invitrogen Life Technologies, Saint Aubin, France). Cells
were then mechanically dissociated in Dulbecco's modified Eagle's medium (DMEM)
supplemented with 10% heat‐inactivated fetal calf serum (FCS) (Biowest LLC/Eurobio,
Les Ulis, France) and 1% penicillin/streptomycin (both from Invitrogen Life
Technologies). The final supernatant was centrifuged at 220g for
5 min and the cells were plated on polyethyleneimine (PEI; Sigma Aldrich)‐coated
culture flasks and incubated at 37°C in a humidified atmosphere containing 95% air
and 5% CO2. Some of the culture medium was removed after 48 hr, but no
additional medium was added until total detachment of astrocytes, after 16–18 days of
culture.
mouse pups, as previously described (Sepulveda‐Diaz et al.,
the meninges were stripped away and brain tissue pieces were placed in 4 ml of
Leibovitz's L‐15 medium (Invitrogen Life Technologies, Saint Aubin, France). Cells
were then mechanically dissociated in Dulbecco's modified Eagle's medium (DMEM)
supplemented with 10% heat‐inactivated fetal calf serum (FCS) (Biowest LLC/Eurobio,
Les Ulis, France) and 1% penicillin/streptomycin (both from Invitrogen Life
Technologies). The final supernatant was centrifuged at 220g for
5 min and the cells were plated on polyethyleneimine (PEI; Sigma Aldrich)‐coated
culture flasks and incubated at 37°C in a humidified atmosphere containing 95% air
and 5% CO2. Some of the culture medium was removed after 48 hr, but no
additional medium was added until total detachment of astrocytes, after 16–18 days of
culture.
9
Optimized Transfection of Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HEK293T and HCT116 cells were grown in a 5% CO2 incubator at 37 °C in Dulbecco’s Modified Eagle Medium (DMEM) and Roswell Park Memorial Institute Medium (RPMI) medium containing 10% fetal bovine serum (FBS, HyClone, Logan, UT, USA), 2 mM glutamine, 100 iU/mL penicillin, and 100 μg streptomycin, as described previously [25 (link)]. Polyethyleneimine (PEI) (Sigma-Aldrich, Saint Louis, MO, USA) was used to transfect CD44 v10 minigenes and expression vectors of Tra2β or SRSF9 into HEK293T and HCT116 cells [40 (link)]. An amount of 1.0 μg plasmid DNAs were mixed with 2.0 μg PEI reagent in 100 μL media and incubated at room temperature for 20 min before adding to culture plate. Total RNAs were extracted at 48 h after transfection using RiboEX reagent (GeneAll, Seoul, Korea) according to the manufacturer’s instructions. Reverse transcription was performed using Moloney Murine Leukemia Virus (M-MLV) reverse transcriptase (ELPIS, Daejeon, Korea) with 1 μg RNA and oligo-dT18 primer. Primer sequences used in this study are listed in Table S1 .
10
Graphene-based Bioelectronic Sensor
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The polyethyleneimine (PEI) (average molecular weight 800 by light scattering), reduced graphene oxide (rGO), napthalenethiol (Naph-SH,99%), silver nitrate (AgNO3), ferritin (10 mg mL−1 in 0.15 M NaCl), glucose oxidase (GOx) from Aspergillus niger and 2% glutaraldehyde aqueous solution were purchased from the Sigma-Aldrich, India. Sodium chloride (NaCl), potassium bromide (KBr), phosphate buffer saline (PBS, pH 7.0), polyvinylpyrrolidone (PVP, molecular weight 1,300,000) and ethylene glycol (EG) were procured from Alfa Aesar, India.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!