Typhoon fla 9000 scanner

The time of addition activity of the (C^S)-cycloaurated complexes was evaluated at −60 min and 0, 2, 6, 12, and 24 h, based on a time-curve assay using Corning black wall, clear bottom 96-well plates containing A549 cells (3 × 10⁴ cells/well) infected with HAdV-RFP (2000 vp/cell) in the presence of Au(dpta)(mrdtc) at 2-fold the IC₅₀ concentration and AuC1, Au(bpta)(dedtc, and Au(dpta)(dedtc) at 10-fold the IC₅₀ concentration, or the same volume of DMSO (positive control). For the −60-min treatment, HAdV-RFP was incubated with the selected compounds on ice for 1 h and then incubated with cells for a further 1 h. Thereafter, the inoculum was removed and replaced with complete DMEM. For the remainder of the treatments, cells were infected for 1 h at 37 °C and the respective compounds were added at the indicated times. A standard infection curve was generated in parallel by infecting cells in the absence of compounds using 2-fold serial dilutions of the virus from an MOI of 2000 vp/cell, thereby enabling an extrapolation of the RFP fluorescence obtained for each compound and the corresponding MOI. Plates were scanned using a Typhoon Fla 9000 scanner (GE Healthcare Life Sciences) and quantified using ImageQuant TL software (GE Healthcare Life Sciences).

Duplex unwinding assays were performed at 37°C in 10 μL reaction buffer containing 20 mM HEPES pH 7.0, 50 mM KCl, 2 mM MgCl_2, 1 mM DTT, 5% glycerol, 0.1% Triton X‐100, and 50 nM cold RNA or DNA oligomer. Annealed substrates (10 nM) were incubated with increasing concentrations of recombinant Suv3 or Suv3ΔC protein for 10 min at 4°C, and the unwinding reactions were initiated by adding 5 mM ATP at 37°C. Reactions were quenched after 1 h by adding 5 μL of stop buffer containing 20 mM HEPES pH 7.4, 300 mM KCl, 10 mM EDTA, and 200 ng/μl proteinase K for 1 h at 37°C. All samples were resolved in 15% native TBE gel, imaged using a Typhoon FLA 9000 scanner (GE Healthcare), and quantified in Image J software.

For RNA degradation assays, 10 nM of Suv3–PNPase protein complex was incubated with 100 nM of 5′‐end FAM‐labeled dsRNA and 5 μM of competitive unlabeled RNA oligonucleotide at 37°C in the reaction buffer containing 20 mM Tris–HCl (pH 7.5), 50 mM NaCl, 5 mM NaH₂PO₄, 1 mM DTT, 1 mM MgCl₂, and 5 mM ATP. Reactions were terminated by adding equal amount of 2X Urea loading dye (BIO‐RAD) at indicated time points (0–60 min) and heating at 95°C for 3 min. Samples were loaded and separated by 20% polyacrylamide gel containing 7 M urea, visualized using a Typhoon FLA 9000 scanner (GE Healthcare), and quantified in Image J software. The RNA substrate used in the degradation assays were purchased from MdBio Inc. with a sequence of:
5′‐FAM‐GCGUCUGCACGUAUGCCACCACACCAGGAGAGGAGAGGAG‐3′ and 5′‐GGUGUGGUGGCAUACGUGCAGACGC‐3′. These two RNA strands were annealed to generate a 20‐basepair RNA duplex with a 20‐nt 3′ overhang.