M mlv reverse transcription kit

HUVEC cells cultured in 12‐well plate were transfected with mimic/mimic NC (RioboBio), inhibitor/inhibitor NC (RioboBio) or treated with TGF‐β1 at 10 ng/mL (Sigma)/TGF‐β1+ inhibitor. 48 hours later, cells were lysed with RNAiso plus (TaKaRa), while cardiac tissues were lysed with RNAiso plus and homogenized. Total RNA was reverse‐transcribed into cDNA using M‐MLV reverse transcription kit (Vazyme). qRT‐PCR was conducted with AceQ qPCR SYBR Green Master Mix (Q141‐02/03, Vazyme) on the ABI StepOnePlus™ Real‐Time PCR System. The primers sequence is as follows: SMAD7, 5′‐GGACGCTGTTGGTACACAAG‐3′, 5′‐GCTGCATAAACTCGTGGTCATTG‐3′; α‐SMA, 5′‐CAGGGGGCACCACTATGTAC‐3′, 5′‐CGGCTTCATCGTATTCCTGTT‐3′; CD31, 5′‐CGTGGTCAACATAACAGAACTA‐3′, 5′‐GTCCGACTTTGAGGCTATCT‐3′; β‐actin, 5′‐GGACTTCGAGCAGGAGATGG‐3′, 5′‐GCACCGTGTTGGCGTAGAGG‐3′.
For reverse transcription and qRT‐PCR analysis of miR‐21, two different Bulge‐Loop™ miRNA qRT‐PCR Primer sets were used to detect the transcriptional level of miR‐21, Bulge‐Loop™ miR‐21 qPCR Primer Set and Bulge‐Loopies™ U6 qPCR Primer Set (RioboBio).

Macrophage colony-stimulating factor enzyme-linked immunosorbent assay (ELISA) kit (YM-QP10199; Shanghai YuanMu Biological Technology Co., Ltd., Shanghai, China), a multifunctional ELISA microplate (Infinite 200 PRO; Coslan scientific LTD, Guangzhou, China), Light Cycler real-time fluorescence quantitative PCR instrument (Roche, Basel, Switzerland), total RNA extraction kit (Solarbio R1200; Shanghai Hengfei Refrigeration Engineering Equipment Co., Ltd., Shanghai, China), M-MLV reverse transcription kit (Vazyme, Nanjing, China), ultraviolet spectrophotometer (Multiskan Sky; Thermo Fisher, Shanghai, China), qReal-time PCR kit (Invitrogen, Grand Island, New York), and SYBR Green qPCR Master Mix kit (Thermo Fisher) were obtained. The primers for miR-21, miR-124, and the internal reference (U6) were synthesized by Sangon Biotech Co, Ltd. (Shanghai, China, Table 1).

AC16 cells and Raji cells, cultured at 37°C with 5% CO₂ for 24 h, were transfected with miR-190a-5p mimic/inhibitor or miR-NC/inhibitor-NC (RiboBio Corporation Limited, Guangzhou, China) for 48 h. The cells were then lysed using RNAiso Plus (Takara Biomedical Technology, Dalian, China). Total RNA was extracted and reverse transcribed into complementary DNA (cDNA) using the M-MLV Reverse Transcription Kit (Vazyme, Nanjing, China) in accordance with the instructions of the manufacturer. qRT-PCR was conducted with AceQ qPCR SYBR Green Master Mix (Q141-02/03, Vazyme, Nanjing, China) on the ABI StepOnePlus™ Real-Time PCR System. The primer sequence used was as follows: IL-2: 5′-AGGCCACAGAACTGAAAC-3′ (Forward), 5′-TTACGTTGATATTGCTGATTA-3′ (Reverse); SCN3B: 5′-GCCTTCAATAGATTGTTTCCCCT-3′ (Forward), 5′-CTCGGGCCTGTAGAACCAT-3′ (Reverse); and glyceraldehyde 3-phosphate dehydrogenase (GAPDH): 5′-GGAGCGAGATCCCTCCAAAAT-3′ (Forward), 5′-GGCT GTTGTCATACTTCTCATGG-3′ (Reverse). For reverse transcription and qRT-PCR of miR-190a-5p, the Bulge-Loop™ qRT-PCR primer sets of miR-190a-5p and U6 were used (RiboBio Corporation Limited, Guangzhou, China).