DNA templates encoding full length ACTB, HSPA8, PABPC1, EEF2 and fragments of HSPA8 were amplified from a U2OS cDNA library. T7 promoter sequence: TAATACGACTCACTATAGGGAG was added in the 5′ end of the DNA template. Transcription was carried out overnight at 37°C in a final volume of 20 μL and using 0.5 μg DNA template using HiScribe RNA synthesis kit (NEB, E2040S). The reaction was stopped by the addition of DNase I, transcription and quality of RNA was checked by agarose gel, and RNA was purified using Monarch RNA purification kit (NEB).
Hiscribe rna synthesis kit
Manufactured by New England Biolabs
The HiScribe RNA Synthesis Kit provides reagents and protocols for the in vitro transcription of RNA from DNA templates. It enables the production of high-quality RNA suitable for a variety of applications.
Automatically generated - may contain errors
Lab products found in correlation
2 protocols using hiscribe rna synthesis kit
1
in vitro RNA Synthesis from cDNA
2
Detecting Bacterial 16S rRNA in Tick Guts
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Forward and reverse universal primers corresponding to regions 533 and 907 nt of bacterial 16S rRNA was used to amplify bacterial 16S rRNA from fed nymphal gut and amplicons cloned into the pGEM Teasy vector (Promega) and verified by sequencing. The Plasmid was linearized to generate sense and antisense RNA by in vitro transcription using T7 or SP6 polymerase with the Hi Scribe RNA synthesis kit (New England Biolabs) and Digoxigenin-11-UTP (Roche) according to the manufacturer’s instructions. Nymphal ticks fed for 48 h were dissected in MEMFA (1M MOPS, 20 mM EGTA, 10 mM MgSO4, 38% Formaldehyde) fixed for one hour, dehydrated in 100% methanol and used to assess presence of bacterial RNA in guts by whole-mount in situ hybridization using Digoxigenin-labeled sense or antisense essentially as described for Xenopus embryos72 (link). Hybridized RNA was detected with alkaline phosphatase-conjugated anti-Digoxigenin antibody (Sigma-Aldrich) and the substrate BM purple (Roche). Guts were visualized using a bright field microscope at 10 X magnification.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!