Primescript rt reagent kit
The PrimeScript RT reagent kit is a reverse transcription kit designed for the conversion of RNA into cDNA. The kit includes the necessary reagents and enzymes to perform this process efficiently.
Lab products found in correlation
24 protocols using primescript rt reagent kit
Quantifying lncRNA and mRNA Levels
Quantitative RT-PCR Analysis of Gene Expression
Quantitative PCR Analysis of miRNA and mRNA
Quantitative Analysis of Fucosyltransferase Gene Expression
Validating Unigenes Expression via qRT-PCR
Total RNA Extraction and RT-qPCR Analysis
Quantitative RT-PCR Analysis of Gene Expression
Quantitative RT-PCR Analysis of PC12 Cells
Quantification of Adhesion and Osteogenesis Genes
Quantification of Immune Gene Expression
IFN-γ, forward 5′- TGCAGAGCCAAATTGTCTCC -3′ and reverse 5′- TGCTTTGCGTTGGACATTCA-3′;
IL-4, forward 5′- TTTGCTGCCTCCAAGAACAC -3′ and reverse 5′- GTCGAGCCGTTTCAGGAATC -3′;
FOXP3, forward 5′- GTGGCCCGGATGTGAGAAG -3′ and reverse 5′- GGAGCCCTTGTCGGATGATG -3′;
and human 18S, forward 5′- CGGCTACCACATCCAAGGAA -3′ and reverse 5′- CTGGAATTACCGCGGCT -3′. Each qRT-PCR reaction comprised the following components: 2 μL cDNA, 2 μL ddH2O, 5 μL SYBR Green PCR Master Mix (Bio-Rad Laboratories, Hercules, CA, USA), and 0.5 μL each of the forward and reverse primers. The qRT-PCR was performed on a MyiQ Single Color Real-Time PCR Detection System (Bio-Rad Laboratories, Hercules, CA, USA) using the following procedure: 95 °C for 3 min; 94 °C for 10 s; 60 °C for 30 s; and 72 °C for 30 s. The fold change in expression of each gene was calculated using the 2-△△CT method, with 18S rRNA used as an internal control.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!