Total RNA of the agent-treated cells was extracted using TRIzol reagent (Invitrogen). Thereafter, the cDNA was synthesized using a cDNA reverse transcription kit (TransGen Biotech, Beijing, China). The qRT-PCR was performed in triplicate on 7900HT real-time PCR instrument (Applied Biosystems, CA, USA) using the SYBR Green Mix (Applied Biosystems). The primer sequences of c-Myc were as follows: forward primer, CTGCGTAGTTGTGCTGATGT; reverse primer, ATCATTTCCATGACGGCCTGT. The relative expression level of c-Myc was normalized to β-actin and then presented by the 2−ΔΔCt.
Cdna reverse transcription kit
Manufactured by Transgene
Sourced in China
The cDNA reverse transcription kit is a laboratory tool used to convert RNA molecules into complementary DNA (cDNA) strands. This process is known as reverse transcription and is a fundamental technique in molecular biology and genetics research.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (10 mentions)
Itaq universal sybr green supermix, by Bio-Rad (3 mentions)
Nanodrop 1000, by Thermo Fisher Scientific (2 mentions)
Cfx96 real time system, by Bio-Rad (2 mentions)
Sybr green pcr kit, by Transgene (2 mentions)
Sybr green mix, by Thermo Fisher Scientific (1 mentions)
7900ht real time pcr instrument, by Thermo Fisher Scientific (1 mentions)
Sybr qpcr mix, by Transgene (1 mentions)
Mxpro software, by Agilent Technologies (1 mentions)
Mx3005p qpcr instrument, by Agilent Technologies (1 mentions)
Primer premier 6, by Premier Biosoft (1 mentions)
7500 real time pcr system, by Thermo Fisher Scientific (1 mentions)
2100 bioanalyzer, by Agilent Technologies (1 mentions)
Plant genomic dna kit, by Tiangen Biotech (1 mentions)
Easyspin plant rna extraction kit, by Aidlab (1 mentions)
Applied biosystems 7500 real time pcr system, by Thermo Fisher Scientific (1 mentions)
Nanodrop 2000 spectrophotometer, by Thermo Fisher Scientific (1 mentions)
Sybr green kit, by Qiagen (1 mentions)
Trizol reagent, by Transgene (1 mentions)
Sybr green pcr master mix, by Takara Bio (1 mentions)
17 protocols using cdna reverse transcription kit
1
qRT-PCR Analysis of c-Myc Expression
2
Zebrafish Larvae Transcriptome Response to β-Sitosterol and CuSO4
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The transcriptome and RT-qPCR analysis methods referred to Reference [20 (link)]. The zebrafish larvae (3 dpf) were transplanted into a six-well plate containing 940 μL E3 medium (30 larvae per well). The 30 hatched larvae in each group were treated with different doses of β-sitosterol (0, 5, 20, 50, 70, or 100 μg/mL) for 1 h and then exposed to 10 μM CuSO4 (a concentration that induces oxidative stress and inflammation [11 (link)]) for 24 h. The larvae were collected after 24 h and stored at −80 °C for RNA extraction. Total RNA was extracted from the larvae using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) [22 (link)]. The concentration (A260) and purity (A260/A280 and A260/A230) of the RNAs were measured using a NanoDrop 1000 instrument (Thermo Fisher Scientific). The RNA integrity was confirmed by electrophoresis in a 1.5% agarose denaturing gel and reverse-transcribed into cDNA using a cDNA reverse transcription kit (Trans Gen Biotech, Wuhan, China). The cycling conditions for RT-qPCR were 95 °C for 10 min followed by 40 cycles of 95 °C for 30 s and 60 °C for 30 s. The results were obtained using the 2−ΔΔct method [23 (link)]. The specific primers used are listed in Table 1 .
3
qPCR Analysis of CLD-Treated SiHa Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
SiHa cells were exposed to 0.5 × 108 cells/mL or 1.0 × 108 cells/mL CLD for 48 h. Total RNA was extracted with Trizol RNA isolation reagents (TransGen Biotech; Beijing, China), followed by cDNA synthesis with a cDNA Reverse Transcription Kit (TransGen Biotech; Beijing, China). The qPCR was conducted with a 10 μL reaction system containing 10 ng of cDNA, 5 μL of SYBR qPCR Mix (TransGen Biotech; Beijing, China), 0.4 μL of primers (10 μM), 0.2 μL of ROX, and ddH2O. A Mx3005P qPCR instrument (Agilent; Santa Clara, California) was used for detection, and data were analyzed using Mxpro software (Agilent; Santa Clara, California). Gene expression levels were normalized to β-Actin. Relevant primer sequences and reaction conditions are shown in Table S1 .
4
Quantitative Analysis of mRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA was extracted from the 3T3-L1 adipocytes treated with PSE and LUT using Trizol reagent (Gene-Protein Link, Beijing, China), and quantified spectrophotometrically. Then, cDNA was synthesized using a cDNA reverse transcription kit (TransGen Biotech, Beijing, China), with 1 μg of RNA used for reverse transcription, according to the instructions of the manufacturer. The mRNA expression level was measured via quantitative real-time PCR using SYBER Green PCR Master Mix (TransGen Biotech, Beijing, China) and a 7500 Real-Time PCR system (Applied Biosystems Foster City, CA, USA) according to the instructions of the manufacturer. The 13 pair primers of targeted genes were designed by Primer Premier 6.0 software (PREMIER Biosoft, Palo Alto, CA, USA) and are shown in Table 1 . Primers were synthesized by Beijing Tsingke Biotechnology Co., Ltd. (Beijing, China). The relative mRNA expression was analyzed using the 2−ΔΔCT method with β-actin. All RT-qPCR analyses were repeated three times.
5
Quantitative RT-PCR Protocol for Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted according to the manufacturer’s protocol for TRIzol Reagent (15596026, Invitrogen, Carlsbad, CA, USA). Equal amount of RNA was reverted to cDNA by using a cDNA reverse transcription kit (AT311-02, Transgene Biotech, Beijing, China). qRT-PCR was performed by using iTaq Universal SYBR Green Supermix (1725125, Bio-Rad, CA, USA) in a CFX96TM Real-Time System (Bio-Rad, CA, USA). The samples underwent two-step amplification with an initial step at 95 °C (3 min), followed by 95 °C (3 s) and 60 °C (31 s) for 39 cycles. The melting curve was analyzed. Fold changes in the expression of each gene were calculated by the comparative threshold cycle method. Each sample was set in duplicated wells. Each experiment was performed in triplicate independently. The sequences of primers purchased from Biosune (Shanghai, China) are shown in Supplementary Table 4 .
6
Quantifying Expression Profiles in Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cultured SK-HEP1 cells, SMMC-7721 cells and HUVECs treated with piperlongumine using TRIzol reagent (Invitrogen, Carlsbad, USA) according to the manufacturer’s instructions. Then, total RNA was reverse transcribed using a cDNA reverse transcription kit (TransGen, Guangzhou, China), and the obtained cDNA was amplified using a SYBR Green PCR kit (TransGen, Guangzhou, China). Quantitative real-time PCR analysis was performed to detect expression in samples. Each experiment was repeated at least three times. The primers used for qRT-PCR were obtained from RiboBio Co., Ltd. The expression of genes was analyzed using 2-ΔΔCT methodology. The specific content of the relevant primers used in qPCR can be found in the support information.
7
Comprehensive Genomic DNA and RNA Extraction
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We conducted genomic DNA and total RNA extraction using a Plant Genomic DNA Kit (Tiangen, Beijing, China) and EASY Spin Plant RNA Extraction Kit (Aidlab, Beijing, China), respectively. The integrity and concentration of the genomic DNA and total RNA were verified using 1.0% agarose gel electrophoresis and a 2100 Bioanalyzer (Agilent Technologies, Palo Alto, CA, USA). Additionally, first-strand cDNA synthesis was performed using a cDNA reverse transcription kit (Transgen, Beijing, China), and the total RNA (1 μg) was studied using oligo (dT) primers according to the manufacturer′s instructions.
8
Liver Total RNA Extraction and qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from 30 to 50 mg frozen liver tissues using TRIzol reagent (Invitrogen, Waltham, MA, USA) in accordance with the manufacturer’s instructions. RNA was quantified with NanoDropTM 2000 Spectrophotometer (ThermoFisher Waltham, MA, USA). In total, 5 μg of RNA was reverse-transcribed to cDNA following 20 μL mixture system: 5 μL total RNA, 10 μL 2 × ES Reaction Mix, 1 μL RT/RI Enzyme Mix, 1 μL Anchored Oligo (dT)18, 3 μL RNase-free water according to cDNA Reverse Transcription Kit (TransGen Biotech, Beijing, China). The determination system was performed on Applied Biosystems 7500 Real-Time PCR System (ThermoFisher. The reaction procedures are as follows: 94 °C for 30 s, 94 °C for 5 s with 40 cycles and 60 °C for 30 s. The PCR primers are listed in Table S1 .
9
Quantifying Gene Expression in Erastin-Treated Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from SK-HEP1 cells and SMMC-7721 cells treated with erastin using TRIzol reagent (Invitrogen, Carlsbad, USA) and reverse transcribed using a cDNA reverse transcription kit (TransGen, Guangzhou, China) in accordance with the manufacturer’s instructions, and the obtained cDNA was amplified using a SYBR Green PCR kit (TransGen, Guangzhou, China). qRT-PCR was performed to detect expression levels in samples. The primers used for qRT-PCR were purchased from TsingKe (Beijing China). Each experiment was repeated three times. The 2-ΔΔCT methodology was adopted to calculate the expression of genes.
10
RT-qPCR Analysis of Liver Tissue
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using TRIzol reagent [40 (link)]. RNA integrity was determined by electrophoresis using 1.5% agarose gels. The concentration (A260) and purity (A260/A280, A260/A230) of the RNAs were measured using a NanoDrop 1000 instrument (Thermo Fisher Scientific, Wilmington, DE, USA). The RNA was reverse transcribed into complementary DNA (cDNA) using a cDNA reverse transcription kit (Trans Gen Biotech, Shanghai, China). Each group consisted of three biological replicates, with three liver tissue samples in each replicate. RT-qPCR was conducted under standard cycle conditions, consisting of an initial denaturation step at 95 °C for 10 min, followed by 40 cycles of amplification at 95 °C for 30 s and annealing/extension at 60 °C for 30 s. The 2−ΔΔCt method was employed for data analysis [41 (link)]. Primer sequences used in this study are shown in Table 1 . β-actin is the housekeeping gene used in this study.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!