Amaxa nucleofector kit 5

Transfection of HNPCs was carried with the Amaxa Nucleofector^® Kit V (Amaxa Biosystems, Köln, Germany) according to the manufacturer’s optimized protocol. In brief, HNPCs were dissociated using 0.05% trypsin for 5 min followed by the addition of 10% FBS in N2 medium. The resuspended cells were counted using a hemocytometer and 5 × 10⁶ cells aliquots were placed in separate tubes (1 tube per nucleofection). The cells were centrifuged at 1000 rpm for 5 min and resuspended in 100 μl of pre-warmed Amaxa Nucleofector Solution. Each 100 μl of cell suspension was mixed with either 10 μg each of pMSCV-IRES-EGFP or pMSCV-Hpca-myc-IRES-EGFP. These DNA-cell suspensions were immediately transferred to Amaxa certified cuvettes and electroporated using the Nucleofector program G-13. The samples were examined by RT-PCR and western blot [see below].

The studies were performed on both wild type HEK 293 cells and HEK 293 cell line stably expressing the human BK_Caα subunit (see [24 (link), 27 (link)–31 (link)]). HEK 293 cells were maintained in Earle's minimal essential medium (containing L-glutamine) supplemented with 10% fetal calf serum, 1% antibiotic/antimycotic, and 1% nonessential amino acids (Gibco BRL, Strathclyde, UK) in a humidified incubator gassed with 5% CO₂/95% air. Where indicated, apoptosis was induced by 48 h of serum deprivation (SD). Knockdown and overexpression of ANXA5 were achieved by transient transfection of cells with specific siRNA and ANXA5 plasmid DNA, respectively. Transfection was achieved using the Amaxa Nucleofector Kit V supplied with green fluorescent protein (GFP) for positive identification of transfected cells, following the manufacturer's protocols (Amaxa Biosystems, Germany). 24 h before performing the electrophysiological experiments, cells were passaged and plated onto glass coverslips, cultured as above, and then transferred into a continuously perfused (5 mL·min⁻¹) recording chamber (volume ca. 200 μL) mounted on the stage of an inverted microscope equipped with phase-contrast and fluorescent optics for (Olympus CK40).

We performed small interfering RNA (siRNA) transfection, as previously described by Al-Roub et al.^{30 (link)}. Briefly, we washed THP-1 monocytic cells and resuspended them in nucleofector solution (100 µl; Amaxa Nucleofector Kit V). We transfected the cells separately with siRNA against ACSL1 (30 nM; OriGene Technologies, Inc., Rockville, MD, USA), scramble siRNA (30 nM; OriGene Technologies, Inc., Rockville, MD, USA), and pmaxGFP (0.5 ug; Amaxa Nucleofector Kit V for THP-1cells, Lonza, Cologne, Germany). We performed all transfection experiments with an Amaxa Cell Line Nucleofector Kit V for monocytic cells (Lonza, city, Germany) using an Amaxa Electroporation System (Amaxa Inc., Cologne, Germany)^{17 (link)}. After 36 h, we treated the siRNA transfected cells with TNFα. Next, after 24 h, we harvested the monocytic cells and conditioned media. Lastly, we assessed the gene knockdown level of ACSL1 using real-time PCR.

CRISPR-mediated TP53 knockout MDA-MB-231 cells were generated using an all-in-one pD1401-AD plasmid expressing the Cas9 nickase (Cas9-D10A), GFP and the 2 gRNAs targeting the TP53 exon that was common to all p53 mRNA isoforms (Supplemental Figure 5). MDA-MB-231 cells were transfected with 1 μg of plasmid by Nucleofection using Amaxa^® Nucleofector^® Kit V (Catalog # VCA-1003). After 48 h, transfected cells were GFP sorted and seeded at one cell per well in 96-well plates containing DMEM. Single colonies were expanded and protein was extracted using RIPA buffer. Knockout clones were genotyped by Sanger sequencing and p53 loss was confirmed by immunoblotting using an Anti-p53 antibody (DO1, Santa Cruz catalog number sc-126). gRNAs sequences targeting TP53: gRNA1- GATGGCCATGGCGCGGACGC; gRNA2- GCAGTCACAGCACATGACGG.