T personal thermal cycler

Genomic DNA of LAB DS15 was used for amplification of 16S rRNA gene. Amplification was done using forward primer 63F (5'-CAG GCC TAA CAC ATG CAA GTC-3') and reverse primer 1387R (5'-GGG CGG GGT GTA CAA GGC-3'). of Laboratory of Medical Molecular Biology and Diagnostic, Indonesian Institute of Sciences. The reaction was carried out in a volume of 50 μl. The PCR mixture contained 22 μl of MQ, 25 μl DreamTaq Green DNA Polymerase (Thermo Fisher Scientific, USA), 1 μl of each forward and reverse primer (10 μM each, IDT synthesized) and 1 μl template. Amplification conditions were 5 minutes of preheating at 95°C, 30 seconds denaturation at 95°C, 30 seconds of primer annealing at 58°C, 1 minute extension step at 72°C and post cycling extension of 5 minutes at 72°C for 35 cycles. The reactions were carried out in a thermal cycler (Biometra's T-Personal Thermal Cycler, USA).

Total DNA was extracted from the identified Aeromonas isolates utilizing a Bacterial and Yeast Genomic DNA Purification Kit (Eurx, Gdańsk, Poland), according to the manufacturer’s guidelines. The isolates were tested for the presence of selected virulence genes (aer, fla, lip, hlyA, ast, alt, act, and ela). The primers and cycling conditions used for the detection of virulence genes were as previously published (Table S1). All reactions were performed in a thermal cycler (T Personal thermal cycler–Biometra GmbH, Goettingen, Germany) using Gold Taq MIX (Syngen Biotech, Wrocław, Poland), appropriate primers (Genomed, Warsaw, Poland), and 1 μL of DNA template.

Nonselective PCR was performed to check digestion and ligation reactions. PCR was carried out in 20 μL volume containing 5 μL of ligated with double-stranded adapters and purified DNA, 0.2 mM of each dNTP, 1.5 mM MgCl₂, 0.4 U Taq DNA polymerase LC, recombinant (Fermentas, Lithuania), 1 X PCR buffer (75 mM Tris-HCl pH 8.8, 20 mM (NH₄)₂SO₄, 0.01% Tween 20), and 750 nM PstI_AF primer. Amplifications were carried out in a T-personal thermal cycler (Biometra, Germany) with the conditions as follows: 95°C for 2 min 30 s followed by 45 cycles of 45 s at 94°C, 45 s at 54°C, and 45 s at 72°C. The final cycle was followed by an additional 10 min at 72°C.

The mycelia from 40 mL liquid cultures were used for DNA extraction according to the method of Borges et al. [39 ]. The purity and quantity of the DNA samples were evaluated using an ND-1000 spectrophotometer (Thermo Scientific, Palm Beach, FL, USA). PCRs were performed using Sigma RedTaq in a T-personal thermal cycler (Biometra, Goettingen, Germany). To confirm the genetic identity of the fungus, the ITS region in the nuclear ribosomal repeat unit was determined by direct sequencing of the PCR products amplified with ITS1-ITS4 primers as described previously [40 (link), 41 ]. Automatic sequencing was performed using a BigDye Terminator Cycle Sequencing Kit and an ABI PRISM 310 or ABI PRISM 3730 XL sequencer (Applied Biosystem).

All extracted DNA samples (from the muscles of 151 slaughtered cattle and 15 buffalo in the molecular survey, as well as from the blood and seven organs of the mortality cases) were screened by a method modified from Ho et al. [18 (link)]. This PCR amplifies an approx. 350 bp portion of the 18S rDNA gene of Sarcocystis spp. with the primers COC-1 (5′-AAG TAT AAG CTT TTA TAC GGC T-3′) and COC-2 (5′-CAC TGC CAC GGT AGT CCA ATA C-3′). The reaction volume was 25 μl, containing 12.5 μl QIAGEN Multiplex PCR Mastermix (2×), 9.5 μl ddH₂O, 0.25 μl (1 μM final concentration) of each primer, and 2.5 μl template DNA. For amplification, an initial denaturation step at 94°C for 10 min was followed by 40 cycles of denaturation at 94°C for 30 s, annealing at 54°C for 30 s and extension at 72°C for 30 s. Final extension was performed at 72°C for 10 min.
Amplification was performed in a T-personal thermal cycler (Biometra, Goettingen, Germany). Purification and sequencing (Biomi Inc.: Gödöllő, Hungary) was done from samples that showed the strongest specific band of PCR product in a 1.5% agarose gel.

DNA extraction procedure was performed according to the method described by Borges et al. [62 (link)]. The purity and quantity of the DNA samples were evaluated using an ND-1000 spectrophotometer (Thermo Scientific, Waltham, MA, USA). PCRs were performed using DreamTaq Green PCR Master Mix (Thermo Scientific, Waltham, MA, USA) in a T-Personal thermal cycler (Biometra, Göttingen, Germany). To confirm the genetic identity of the fungus, the ribosomal RNA gene fragment was amplified using the universal primers ITS1 (TCCGTAGGTGAACCTGCGG) and ITS4 (TCCTCCGCTTATTGATATGC) as described previously. The amplified region was analyzed by direct sequencing of the PCR products. Automatic sequencing was performed using a BigDye™ Terminator Cycle Sequencing Kit and ABI PRISM 310/3730 XL sequencers (Applied Biosystem, Foster City, CA, USA). Data from ITS sequencing was analyzed with ChromasPro v.1.6 (Technelysium Pty Ltd., South Brisbane, Australia) and Lasergene v.11.0 software (DNASTAR, Inc, Madison, WI, USA). Database searches were performed with the BLAST program at the National Centre for Biotechnology Information (Bethesda, Rockville, MD, USA) [63 (link)].