Log In Sign up
The largest database of trusted experimental protocols

Pe conjugated anti human cd19

Manufactured by BD
Visit Supplier

The PE-conjugated anti-human CD19 is a monoclonal antibody that binds to the CD19 antigen expressed on the surface of B cells. It is a tool used for the identification and enumeration of B cells in flow cytometry applications.

Automatically generated - may contain errors

Lab products found in correlation

Pe conjugated anti human cd105, by BD (3 mentions) Fitc conjugated anti human cd90, by BD (3 mentions) Pe conjugated anti hla abc, by BD (3 mentions) Fitc conjugated anti hla dr, by BD (3 mentions) Fitc conjugated anti human cd34, by BD (3 mentions) Pe conjugated anti human cd 11b, by BD (3 mentions) Apc conjugated anti cd45, by BD (3 mentions) Fitc conjugated anti human cd44, by BD (3 mentions) Apc conjugated anti mouse cd86, by BioLegend (2 mentions) Apc conjugated anti human cd73, by BD (2 mentions) Pe conjugated anti mouse cd206, by Thermo Fisher Scientific (2 mentions) Human msc analysis kit, by BD (1 mentions) Fitc conjugated anti human cd3, by BD (1 mentions) Apc conjugated anti human cd56, by BD (1 mentions) Facscalibur, by BD (1 mentions) Cellquest software, by BD (1 mentions) Live dead fixable near ir dead cell stain kit, by Thermo Fisher Scientific (1 mentions) Gallios flow cytometer, by Beckman Coulter (1 mentions) Facscanto 2 flow cytometer, by BD (1 mentions) Human vegfa165, by Thermo Fisher Scientific (1 mentions)

7 protocols using pe conjugated anti human cd19

1

Characterizing Mesenchymal Stem Cells by Flow Cytometry

Check if the same lab product or an alternative is used in the 5 most similar protocols
Standard flow cytometry was performed to determine the presence of MSC markers, as defined by the International Society for Cellular Therapy.15 UC‐MSCs were stained using a Human MSC Analysis kit (BD Biosciences, Franklin Lakes, NJ, USA) containing the following mouse monoclonal antibodies, which are positive markers for MSCs: fluorescein isothiocyanate (FITC)‐conjugated anti‐human CD90; phycoerythrin (PE)‐conjugated anti‐human CD105; allophycocyanin (APC)‐conjugated anti‐human CD73; FITC‐conjugated anti‐human CD44 (BD Biosciences), and PE‐conjugated anti‐HLA‐ABC (BD Biosciences). Additionally, UC‐MSCs were stained with FITC‐conjugated anti‐HLA‐DR (BD Biosciences), FITC‐conjugated anti‐human CD34 (BD Biosciences), PE‐conjugated anti‐human CD11b (BD Biosciences), PE‐conjugated anti‐human CD19 (BD Biosciences), or APC‐conjugated anti‐CD45 (BD Biosciences); these are negative markers for MSCs. Propidium iodide was used to identify and exclude dead cells using flow cytometry, as previously described.16
Tsuji S., Mukai T., Tsuchiya H., Iwatani C., Nakamura A., Nagamura‐Inoue T, & Murakami T. (2023). Impact of administering umbilical cord‐derived mesenchymal stem cells to cynomolgus monkeys with endometriosis. Reproductive Medicine and Biology, 22(1), e12540.
+ Open protocol
+ Expand
2

Multiparametric Flow Cytometry Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Mononuclear cells were suspended in 100 μl of phosphate-buffered saline and incubated with antibodies. After washing, cells were analyzed using a FACSCalibur flow cytometer equipped with Cell Quest software (BD Biosciences, San Diego, CA) and FlowJo software. The antibodies used to detect cells included APC-conjugated anti-human CD1d tetramer (Proimmune, D001-4A), FITC-conjugated anti-human CD3 (BD, 555339), APC-conjugated anti-human CD56 (BD, 555518), FITC and PE-conjugated anti-human CD3/CD16+CD56 (340042, BD Simultest), PE-Cy5-conjugated anti-human CD4 (555348, BD Pharmingen), PerCP-conjugated anti-human CD8 (347314, BD Pharmingen), and PE-conjugated anti-human CD19 (340364, BD Pharmingen). Flow cytometric data were analyzed using appropriate controls of proper isotype-matched IgG and unstained samples.
Lee S.E., Lee J.Y., Han A.R., Hwang H.S., Min W.S, & Kim H.J. (2018). Effect of High VEGF-C mRNA Expression on Achievement of Complete Remission in Adult Acute Myeloid Leukemia. Translational Oncology, 11(3), 567-574.
+ Open protocol
+ Expand
3

Multiparametric Flow Cytometry Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
The MSCs were stained using the following mouse monoclonal antibodies: fluorescein isothiocyanate (FITC)-conjugated anti-human CD90, phycoerythrin (PE)-conjugated anti-human CD105, allophycocyanin (APC)-conjugated anti-human CD73, FITC-conjugated anti-human CD44 (BD Biosciences), PE-conjugated anti-HLA-ABC (BD Biosciences), FITC-conjugated anti-HLA-DR (BD Biosciences), FITC-conjugated anti-human CD34 (BD Biosciences), PE-conjugated anti-human CD 11b (BD Biosciences), PE-conjugated anti-human CD 19 (BD Biosciences), and APC-conjugated anti-CD45 (BD Biosciences). Propidium iodide was used to identify and exclude the dead cells. The stained cells were acquired with a FACS Canto II flow cytometer (BD Biosystems) and analyzed using the FlowJo software (Tomy Digital Biology, Co. Ltd.). As for microglia, EYFP-expressing microglia were stained using APC-conjugated anti-mouse CD86 (BioLegend), PE-conjugated anti-mouse CD206 (ThermoFisher), and the Live/Dead™ fixable near-IR dead cell stain kit (Invitrogen). The stained cells were acquired with a Gallios flow cytometer (Beckman Coulter) and analyzed using the FlowJo software (Tomy Digital Biology, Co. Ltd.). Three independent FACS experiments were performed.
Mukai T., Di Martino E., Tsuji S., Blomgren K., Nagamura-Inoue T, & Ådén U. (2021). Umbilical cord-derived mesenchymal stromal cells immunomodulate and restore actin dynamics and phagocytosis of LPS-activated microglia via PI3K/Akt/Rho GTPase pathway. Cell Death Discovery, 7, 46.
+ Open protocol
+ Expand
4

Monocyte-Endothelial Cell Interaction Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
Human microvascular ECs (HMVECs) and the U937 human monocyte cell line were purchased from ATCC. Phorbol 12-myristate 13-acetate (PMA) was obtained from Sigma-Aldrich. The secretory transporter inhibitor monensin and the following antibodies were from Biolegend: phycoerythryin (PE)-Cy7 conjugated anti-CD14 and Brilliant Violet (BV605)-conjugated anti-CD3. PE-conjugated anti human CD19 was from BD Biosciences. Allophycocyanin-conjugated anti-ADM was from US Biological. Recombinant human ADM was purchased from GenScript, and human VEGF-A165 was from Peprotech.
Xie Z., Chen W.S., Yin Y., Chan E.C., Terai K., Long L.M., Myers T.G., Dudek A.Z, & Druey K.M. (2018). Adrenomedullin surges are linked to acute episodes of the Systemic Capillary Leak Syndrome (Clarkson disease). Journal of leukocyte biology, 103(4), 749-759.
+ Open protocol
+ Expand
5

Lentiviral Transduction of CD34+ Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
CD34+ cells from three to ten distinct cord blood samples were pooled and transduced with lentiviruses (pRRLsin-PGK-eGFP-WPRE, Genethon, Evry, France) expressing the green fluorescent protein and either a short hairpin RNA targeting TET2 (shRNA-TET2, 5′- GGGTAAGCCAAGAAAGAAA -3′) or a scramble sequence (shRNA-scramble, 5′- GCCGGCAGCTAGCGACGCCAT -3′) as control23 (link). Twenty-four hours after transduction, 2 × 105 cells were intravenously injected to sublethally irradiated NSG female mice (6–8 weeks old). Mice were killed 15–17 weeks after injection, and repopulation of mouse bone marrow (femurs and tibias) by human cells was assessed by flow cytometry, using APC-conjugated mouse anti-human CD45, PE-conjugated anti-human CD19, PE-conjugated anti-CD33 (all from BD Pharmingen). Antibodies are listed in the Supplementary Information (Supplementary Table 14).
For NGS experiments and for secondary transplantation, bone marrow of repopulated mice was enriched in human cells using a mouse/human chimera isolation kit (Stem Cell Technologies).
Hirsch P., Zhang Y., Tang R., Joulin V., Boutroux H., Pronier E., Moatti H., Flandrin P., Marzac C., Bories D., Fava F., Mokrani H., Betems A., Lorre F., Favier R., Féger F., Mohty M., Douay L., Legrand O., Bilhou-Nabera C., Louache F, & Delhommeau F. (2016). Genetic hierarchy and temporal variegation in the clonal history of acute myeloid leukaemia. Nature Communications, 7, 12475.
+ Open protocol
+ Expand
6

Characterization of MSCs and Microglia

Check if the same lab product or an alternative is used in the 5 most similar protocols
The MSCs were stained using the following mouse monoclonal antibodies: uorescein isothiocyanate (FITC)-conjugated anti-human CD90, phycoerythrin (PE)-conjugated anti-human CD105, allophycocyanin (APC)-conjugated anti-human CD73, FITC-conjugated anti-human CD44 (BD Biosciences), PE-conjugated anti-HLA-ABC (BD Biosciences), FITC-conjugated anti-HLA-DR (BD Biosciences), FITC-conjugated antihuman CD34 (BD Biosciences), PE-conjugated anti-human CD 11b (BD Biosciences), PE-conjugated antihuman CD 19 (BD Biosciences), and APC-conjugated anti-CD45 (BD Biosciences). Propidium iodide was used to identify and exclude the dead cells. The stained cells were acquired with a FACS Canto II ow cytometer (BD Biosystems) and analyzed using the FlowJo software (Tomy Digital Biology, Co. Ltd.). As for microglia, EYFP-expressing microglia were stained using APC-conjugated anti-mouse CD86 (BioLegend), PE-conjugated anti-mouse CD206 (ThermoFisher), and the Live/Dead™ xable near-IR dead cell stain kit (Invitrogen). The stained cells were acquired with a Gallios ow cytometer (Beckman Coulter) and analyzed using the FlowJo software (Tomy Digital Biology, Co. Ltd.). Three independent FACS experiments were performed.
Mukai T., Martino E.D., Tsuji S., Blomgren K., Nagamura‐Inoue T., & Ådén U. (2020). Umbilical cord-derived mesenchymal stromal cells immunomodulate and restore actin dynamics and phagocytosis of LPS-activated microglia via PI3K/Akt/Rho GTPase pathway.
+ Open protocol
+ Expand
7

Immunophenotyping of B-cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
The whole blood from subjects was incubated for an hour at room temperature with PE-conjugated anti-human CD19 (BD Biosciences) and FITC-conjugated anti-human CD40 (invitrogen). FITC-conjugated mouse IgG1 was used as isotype control. Then the blood was hemolyzed and fixed. The cells were analyzed in a Coulter, Epics XL flow cytometer (Beckman Coulter, Germany).
Zhou C., Jin X., Tang J., Fei J., Gu C, & Chen X. (2015). Association of CD40 -1C/T polymorphism in the 5'-untranslated region with chronic HBV infection. Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 35(1).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!