Rnaprep pure plant total rna extraction kit

Plant material was collected as previously described [39 (link)]. Briefly, the fruits of the ‘Furongli’ plum were harvested from 6-year-old field-grown trees in Fuda Village, Fujian Province, China. Fruit samples were picked 23, 43, 70, 98, 112, 127, and 157 days after flowering (DAF), respectively. All the trees received the standard horticultural practices and insect prevention. The fruit samples were stored at −80 °C until use. After that, they were peeled and sliced into appropriate pieces and frozen in liquid nitrogen immediately. For qRT-PCR analysis, the total RNA was isolated using the RNA prep Pure Plant Total RNA Extraction Kit (Tiangen, Beijing, China) following the manufacturer’s instructions. First-strand cDNA was synthesized for qPCR using the PrimeScript RT reagent kit with gDNA Eraser (Takara, Dalian, China). The qRT-PCR reactions were conducted in 20 µL volumes, utilizing 1 µL of cDNA and 2 × SYBR Premix Ex TaqTM II (Tli RNaseH Plus, TaKaRa), based on the Eppendorf RealPlex4 system (Hamburg, Germany). The experiment procedures of qRT-PCR were 40 cycles of 95 °C for 15 s and then 68 °C for 30 s. The actin gene was utilized as the control standard, and the 2^−ΔΔCT method was employed to analyze the relative expression levels of the genes [40 (link)]. Three biological and three technical replicates were performed. The primer sequences are provided in Table S1.

One-month-old cassava cultivar SC8 seedlings were used as material for total cassava RNA extraction using the RNAprep Pure Plant Total RNA Extraction Kit (TianGen, Beijing, China) according to the manufacturer’s instructions. After detection by 1% gel electrophoresis, the total RNA was first treated to remove the genomic DNA, then transferred into the first strand of cDNA by using the PrimeScript RT reagent kit with gDNA Eraser (TaKaRa, Dalian, China) according to the manufacturer’s instructions. The first strand of synthesized cDNA was used as a template, and Me-Tubulin-F/R was used as upstream and downstream primers to detect the quality of reverse transcription.
To clone the cDNA of MeAnn2 from cassava, the primer pairs MeAnn2-F: GAGTCTACACAGAGCAGAGAGCCT and MeAnn2-R: TATTCCCCGTTGAAACCACA, were designed using Primer Premier 5 outside the coding region, and the high-fidelity enzyme Prime STAR HS (Premix) (TaKaRa, Dalian, China) was used to perform the PCR reaction. The amplified product was recovered, directly ligated to the pMD-19T vector using the TA cloning method according to the operating instruction of pMD™19-T Vector Cloning Kit (TaKaRa, Dalian, China), and then transformed into DH-5α competent cells. The positive clones, identified by bacterial liquid PCR using the BcaBEST Sequencing Primers RV-M and M13-47 in the pMD-19T vector, were sent for DNA sequencing.

Total RNA was extracted with an RNAprep Pure Plant Total RNA Extraction Kit (Tiangen Biotech, Co., Ltd., Beijing, China). Then, cDNA was acquired by reverse transcription of RNA samples with a cDNA Synthesis Kit (Yesen Biotech, Co., Ltd., Shanghai, China). The nucleic acid concentrations of total RNA and cDNA were determined from the A₂₆₀ and A₂₈₀ values by a NanoDrop 2000c (Thermo Fisher Scientific, Inc., Waltham, MA, United States). The primer sequences are listed in Supplementary Table S1. Each cDNA sample was used as a template and mixed with primers and qPCR SYBR^® Green Master Mix (Yesen Biotech, Co., Ltd.). RT-PCR analysis was performed by iQ5 (Bio-Rad Laboratories, Inc., United States). To obtain relative gene expression for each sample, the threshold cycle (C_t) value was normalized to actin and compared to the control samples according to the 2^-ΔΔCt method. Each sample was evaluated with three replications.

The RNAprep Pure plant total RNA extraction kit (Tiangen, Beijing, China) was used to extract the total RNA from the MLT 100 and CK groups simultaneously. Then, through transcribed one-step gDNA removal and cDNA synthesis SuperMix (TransGen Biotech, Beijing, China), the cDNA was derived from the RNA samples. The SYBR Green method was utilized in the quantitative real-time PCR (qRT–PCR) assays that were carried out with Talent qPCR Premix (Tiangen, Beijing, China). The relative expression level of each gene was estimated using the 2^−ΔΔCt technique. Table S11 lists a comprehensive inventory of the qRT-PCR primers.