Qiaamp minielute virus spin kit

The genomic region covering the HBV core gene was amplified and sequenced from patients enrolled in this study. Viral DNA was extracted with the QIAamp MiniElute Virus Spin Kit (Qiagen, Hilden, Germany) according to the manufacturer's protocol. A 700-bp core fragment was amplified in a two-step nested polymerase chain reaction (PCR) using HBV-specific primers HBV core-forward (tgtcaacgaccgaccttgagg), HBV core-reverse (tgtagctcttgttcccaa), HBV core internal-forward (aggctgtaggcataaattggt), and HBV core internal-reverse (ttcccaccttatgagtccaag), as previously described (Supplementary Table 1) (27 (link)). PCR products were directly sequenced and aligned by Cosmogenetech (Seoul, Republic of Korea).

Sample processing was done within 4 h of venepuncture, and plasma was stored continuously at −80°C until use. Viral nucleic acids were extracted from 200 μl of plasma using the QIAamp MiniElute Virus Spin Kit (Qiagen, Limburg, Netherlands). CMV viral load was determined using the RealStar CMV PCR Kit 1.0 (Altona Diagnostics, Hamburg, Germany) following the manufacturer's instructions. Real-time quantitative PCR was done using the ABI Prism 7500 SDS instrument (Applied Biosystems, Waltham, Massachusetts, USA). A single 96-well plate run was used for all HEU and HUU samples, a negative control and four standards calibrated against the first WHO International Standard for Human CMV Nucleic Acid Amplification (these served to generate a standard curve, as quality controls, and as a positive control). The assay limit of detection is estimated to be 92.1 IU/ml. Viraemia was defined as a measurable viral load, as per manufacturer's recommendations, and viral loads are presented as log₁₀ IU/ml of peripheral blood.

Clinical specimens consisted of a nasopharyngeal aspirate (NPA) taken from each patient at admission. All clinical specimens were sent for virological investigation to the Respiratory Virus and Influenza Unit at the National Microbiology Center (ISCIII, Madrid, Spain), NPAs were processed within 24 hours after collection. Upon receipt, three aliquots were prepared and stored at -70°C.
RNA and DNA from 200 μl-aliquots of NPA were extracted by using the QIAamp Mini Elute Virus spin kit in an automated extractor (QIAcube, Qiagen, Valencia, CA). From 2005 to 2010, three conventional multiplex RT-nested-PCR assays were performed to detect a total of sixteen respiratory viruses [9 (link),10 (link),11 (link)]. From 2011 to 2014, detection of HMPV and the other respiratory virus were performed by real time multiplex RT-PCR assays, not published yet, but based on the same equivalent conventional methods (9, 10, 11).

Serum was obtained by centrifugation for 10 min at 400 × g and stored at −80°C until required for analysis. Samples were tested for anti‐HEV IgG and anti‐HEV IgM antibodies by commercial ELISA (recomWell HEV IgG/IgM®; Mikrogen Diagnostik, Neuried, Germany) using an automated procedure (Automatic ELISA workstation DS2®, Dynex Technologies). The analyses were carried out in accordance with the instructions provided by the manufacturer using a cut‐off value ≥ 24 U/ml for positive samples. Antibodies quantitative value are presented in U/ml, not related with the WHO international standard. The specimens with a value‐to‐cut‐off ratio between 20 and 24 U/ml were considered borderline. Confirmatory testing was performed using immunoblotting (recomLine HEV IgG/IgM®; Mikrogen Diagnostik, Neuried, Germany), following a manual procedure according to the manufacturer's instructions for all positive samples. RNA was extracted from 400 μl of serum using the commercial QIAamp Mini Elute Virus Spin Kit (QIAgen, Hilden, Germany) by an automated procedure (QIAcube. QIAgen, Hilden, Germany). The purified RNA was eluted in a volume of 50 μl. RT q‐PCR for HEV was performed using the QIAgen One‐Step PCR Kit (QIAgen, Hilden, Germany), following an in‐house protocol described previously by our group (Frías et al., 2021 (link)).