Log In Sign up
The largest database of trusted experimental protocols

Pyromark q96 mgmt kit

Manufactured by Qiagen
Visit Supplier
Sourced in France

The PyroMark Q96 MGMT kit is a laboratory equipment product designed for the analysis of the MGMT gene methylation status. It provides a reliable and accurate method for quantitative assessment of MGMT promoter methylation levels.

Automatically generated - may contain errors

Lab products found in correlation

Psqtm96 ma system, by Biotage (4 mentions) Streptavidin coated sepharose beads, by GE Healthcare (2 mentions) Absolute sybr green rox mix, by Thermo Fisher Scientific (1 mentions) Abi prism snapshot multiplex kit, by Thermo Fisher Scientific (1 mentions) Qiamp dna mini kit, by Qiagen (1 mentions)

Spelling variants of this product

PyroMark Q96 (70 citations) PyroMark kit (18 citations) PyroMark MGMT kit (4 citations) PyroMark Q96 CpG MGMT kit (3 citations)

4 protocols using pyromark q96 mgmt kit

1

Pyrosequencing-based DNA Methylation Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
As a technical validation we used pyrosequencing to carry out replication testing of the relationship between DNA methylation and BMI at 4 loci, using samples of whole blood from 990 Europeans and 1,720 Indian Asians participating in the LOLIPOP study. Pyrosequencing was carried out using biotinylated primers to amplify bisulfite-treated DNA (Supplementary Information Table 26). The biotinylated PCR products were then immobilized on streptavidin-coated Sepharose beads (GE Healthcare, Orsay, France). Pyrosequencing was performed with the PyroMark Q96 MGMT kit (Qiagen, Courtaboeuf, France) on a PSQTM96 MA system (Biotage, Uppsala, Sweden).
Wahl S., Drong A., Lehne B., Loh M., Scott W.R., Kunze S., Tsai P.C., Ried J.S., Zhang W., Yang Y., Tan S., Fiorito G., Franke L., Guarrera S., Kasela S., Kriebel J., Richmond R.C., Adamo M., Afzal U., Ala-Korpela M., Albetti B., Ammerpohl O., Apperley J.F., Beekman M., Bertazzi P.A., Black S.L., Blancher C., Bonder M.J., Brosch M., Carstensen-Kirberg M., De Craen A.J., de Lusignan S., Dehghan A., Elkalaawy M., Fischer K., Franco O.H., Gaunt T.R., Hampe J., Hashemi M., Isaacs A., Jenkinson A., Jha S., Kato N., Krogh V., Laffan M., Meisinger C., Meitinger T., Mok Z.Y., Motta V., Ng H.K., Nikolakopoulou Z., Nteliopoulos G., Panico S., Pervjakova N., Prokisch H., Rathmann W., Roden M., Rota F., Rozario M.A., Sandling J.K., Schafmayer C., Schramm K., Siebert R., Slagboom P.E., Soininen P., Stolk L., Strauch K., Tai E.S., Tarantini L., Thorand B., Tigchelaar E.F., Tumino R., Uitterlinden A.G., van Duijn C., van Meurs J.B., Vineis P., Wickremasinghe A.R., Wijmenga C., Yang T.P., Yuan W., Zhernakova A., Batterham R.L., Smith G.D., Deloukas P., Heijmans B.T., Herder C., Hofman A., Lindgren C.M., Milani L., van der Harst P., Peters A., Illig T., Relton C.L., Waldenberger M., Järvelin M.R., Bollati V., Soong R., Spector T.D., Scott J., McCarthy M.I., Elliott P., Bell J.T., Matullo G., Gieger C., Kooner J.S., Grallert H, & Chambers J.C. (2016). Epigenome-wide association study of body mass index, and the adverse outcomes of adiposity. Nature, 541(7635), 81-86.
+ Open protocol
+ Expand
2

Pyrosequencing-based DNA Methylation Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
As a technical validation we used pyrosequencing to carry out replication testing of the relationship between DNA methylation and BMI at 4 loci, using samples of whole blood from 990 Europeans and 1,720 Indian Asians participating in the LOLIPOP study. Pyrosequencing was carried out using biotinylated primers to amplify bisulfite-treated DNA (Supplementary Information Table 26). The biotinylated PCR products were then immobilized on streptavidin-coated Sepharose beads (GE Healthcare, Orsay, France). Pyrosequencing was performed with the PyroMark Q96 MGMT kit (Qiagen, Courtaboeuf, France) on a PSQTM96 MA system (Biotage, Uppsala, Sweden).
Wahl S., Drong A., Lehne B., Loh M., Scott W.R., Kunze S., Tsai P.C., Ried J.S., Zhang W., Yang Y., Tan S., Fiorito G., Franke L., Guarrera S., Kasela S., Kriebel J., Richmond R.C., Adamo M., Afzal U., Ala-Korpela M., Albetti B., Ammerpohl O., Apperley J.F., Beekman M., Bertazzi P.A., Black S.L., Blancher C., Bonder M.J., Brosch M., Carstensen-Kirberg M., De Craen A.J., de Lusignan S., Dehghan A., Elkalaawy M., Fischer K., Franco O.H., Gaunt T.R., Hampe J., Hashemi M., Isaacs A., Jenkinson A., Jha S., Kato N., Krogh V., Laffan M., Meisinger C., Meitinger T., Mok Z.Y., Motta V., Ng H.K., Nikolakopoulou Z., Nteliopoulos G., Panico S., Pervjakova N., Prokisch H., Rathmann W., Roden M., Rota F., Rozario M.A., Sandling J.K., Schafmayer C., Schramm K., Siebert R., Slagboom P.E., Soininen P., Stolk L., Strauch K., Tai E.S., Tarantini L., Thorand B., Tigchelaar E.F., Tumino R., Uitterlinden A.G., van Duijn C., van Meurs J.B., Vineis P., Wickremasinghe A.R., Wijmenga C., Yang T.P., Yuan W., Zhernakova A., Batterham R.L., Smith G.D., Deloukas P., Heijmans B.T., Herder C., Hofman A., Lindgren C.M., Milani L., van der Harst P., Peters A., Illig T., Relton C.L., Waldenberger M., Järvelin M.R., Bollati V., Soong R., Spector T.D., Scott J., McCarthy M.I., Elliott P., Bell J.T., Matullo G., Gieger C., Kooner J.S., Grallert H, & Chambers J.C. (2016). Epigenome-wide association study of body mass index, and the adverse outcomes of adiposity. Nature, 541(7635), 81-86.
+ Open protocol
+ Expand
3

Comprehensive Genomic Profiling of FFPE Samples

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
DNA was extracted from formalin-fixed paraffin-embedded samples using a standard protocol (QIAmp DNA mini Kit, Qiagen). After PCR amplification, the mutations of codon 132 of IDH1, codon 172 of IDH2, codons 27 and 34 of H3F3A, codon 28 of HIST1H3B, codon 600 of BRAF, as well as mutational hotspots C228 and C250 of the TERT promoter were investigated by single-nucleotide primer extension with the ABI PRISM SNaPshot Multiplex kit, Applied Biosystems.18 (link)MGMT promoter methylation was assessed by pyrosequencing, which was performed using the PyroMark Q96 MGMT kit (Qiagen) on a PSQTM96 MA system (Biotage).19 (link)EGFR gene amplification was detected by using SYBR Green real-time quantitative polymerase chain reaction (qPCR) analysis (Absolute SYBR Green Rox Mix; Abgene) with the following set of primers EGFR-F: GTGCAGATCGCAAAGGTAATCAG, EGFR-R: GCAGACCGCATGTGAGGAT; hydrolysis probe: FAM CCCCTCCCCCGTATCTC.20 (link)
Picart T., Barritault M., Poncet D., Berner L.P., Izquierdo C., Tabouret E., Figarella-Branger D., Idbaïh A., Bielle F., Bourg V., Vandenbos F.B., Moyal E.C., Uro-Coste E., Guyotat J., Honnorat J., Gabut M., Meyronet D, & Ducray F. (2021). Characteristics of diffuse hemispheric gliomas, H3 G34-mutant in adults. Neuro-oncology Advances, 3(1), vdab061.
+ Open protocol
+ Expand
4

Tumor DNA Extraction and Mutational Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Tumor DNA was isolated using the EPICENTER Tissue DNA extraction kit (Tebu Bio). RET gene mutations were analyzed by PCR and sequencing.
O 6 -methylguanine-DNA methyltransferase Status As previously described [5] , O(6)-methylguanine-DNA methyltransferase (MGMT) promoter methylation status was studied using methyl-specific PCR and pyrosequencing, performed using a PyroMark Q96 MGMT kit (Qiagen, Courtaboeuf, France) on a PSQTM96 MA system (Biotage, Uppsala, Sweden).
Wang J.Z., Cowley A, & McLellan B.N. (2016). Differentiating hand-foot syndrome from tinea in patients receiving chemotherapy. Acta oncologica (Stockholm, Sweden), 55(8).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!