C7070 wide zoom digital camera

All spiders are preserved in a 95% ethanol solution. All types are deposited in the Institute of Zoology, Chinese Academy of Sciences in Beijing (IZCAS). Specimens were examined and measured using a Leica M205 C stereomicroscope. Further details were studied with an Olympus BX41 compound microscope. Photos were taken with an Olympus C7070 wide zoom digital camera (7.1 megapixels) mounted on an Olympus SZX12 stereomicroscope. The images were prepared using Helicon Focus 3.0 image stacking software and further processed with Adobe Photoshop. The map was generated in Arcview 3.3. Leg measurements are shown as total length (femur, patella, tibia, metatarsus, tarsus). Leg segments were measured from their retrolateral side. All measurements are given in millimetres (mm). Spider terminology follows that of Li et al. (2014) (link) and Deeleman-Reinhold (1995) .

All specimens studied in this paper were collected from southwest China. Fresh specimens were preserved in 95% ethanol with storage at -20 °C for DNA extraction and 75% ethanol for morphological study. Specimens were examined with a LEICA M205 C stereomicroscope. Photos were taken with an Olympus C7070 wide zoom digital camera (7.1 megapixels) mounted either on an Olympus SZX12 dissecting microscope or on an Olympus BX51 compound microscope. Images from multiple focal ranges were combined using Helicon Focus v. 6.80 photo stacking software program. The epigyne and male palp were dissected from the body for examination. The epigyne was treated in a warm 10% potassium hydroxide (KOH) solution. Images of the left male palp are presented. Measurements were obtained with a LEICA M205 C stereomicroscope and are given in millimetres. Eye diameters were measured as the maximum distance in either dorsal or frontal views. Leg measurements are given as follows: total length (coxa, trochanter, femur, patella, tibia, metatarsus, tarsus). Terminology follows Wang et al. (1990) , Peng and Wang (1997) and Zhu et al. (2017) . Abbreviations are as follows:

For a general macroscope overview, expanded leaves and disc florets from the capitula of S. impressa were examined under an Olympus SZH-ILLK stereomicroscope (Olympus Optical Co., Ltd., Tokyo, Japan). Images were recorded using an Olympus C-7070 Wide Zoom digital camera (Olympus Imaging Corp., Tokyo, Japan).

Specimens were examined with a LEICA M205C stereomicroscope. Images were captured with an Olympus C7070 wide zoom digital camera (7.1 megapixels) mounted on an Olympus SZX12 dissecting microscope. Epigynes and male palps were examined after dissection from the spiders’ bodies.
Terminology and abbreviations in this paper generally follow Wang and Li (2011) and Ledford (2011) . The unit of measurement in this paper is millimetres (mm). Leg metric data were recorded as total length (femur, patella, tibia, metatarsus, tarsus). Leg segments were measured on their dorsal side.
DNA barcodes were obtained for future use. A partial fragment of the mitochondrial gene

cytochrome oxidase subunit I

(COI) was amplified and sequenced for Leptonetelaarvanitidisi sp. n., Leptonetelaparagamiani sp. n. and Leptonetelapenevi sp. n. following the protocol in Miller et al. (2010) (link). Primers used in this study are: LCO1490 (5’-CWACAAAYCATARRGATATTGG-3’) and HCO-N-2198 (5’- TAAACTTCAGGGTGACCAAAAAATCA -3’) (Folmer et al. 1994 (link)). Voucher information and GenBank accession number for all samples are listed in Table 1.
The specimens studied in the current paper are deposited in the

Institute of Zoology, Chinese Academy of Sciences

(IZCAS) in Beijing, China.

The material came from Xishuangbanna in South Yunnan (21°08'N–22°36'N, 99°56'E–101°50'E). The area belongs to the transitional zone from tropical South to subtropical East Asia (Zhu et al. 2004 ). The region has an area of 19,120 km², with mountain ridges running north-south, and the elevation decreasing southwards. The current study is based on 10 years of collecting in Xishuangbanna. More details on the spider diversity in the area and collection methods can be found in Zheng et al. (2015) .
The specimens were preserved in 95% ethanol and were examined and measured with Olympus SZX12 and BX41 microscopes. Photos were taken with an Olympus C7070 wide zoom digital camera mounted on an Olympus SZX12 stereomicroscope. The images were processed with Helicon image stacking software. Vulvae were removed and digested with lactic acid or a 10% warm solution of

potassium hydroxide

(KOH). All measurements are in millimetres. References to figures in the cited papers are listed in lowercase type (fig. or figs); figures in this paper are noted with an initial capital (Fig. or Figs).

All specimens were examined and measured with a Leica M205C stereomicroscope. Images of male pedipalps and female epigynes were taken with an Olympus C7070 wide zoom digital camera (7.1 megapixels) mounted on an Olympus BX51 compound light microscope after removing them from the spiders’ bodies. Images of bodies were taken with an Olympus C7070 camera mounted on an Olympus SZX12 dissecting microscope. Epigynes were cleaned and treated in trypsin and if necessary, in boiling solution of potassium hydroxide (KOH) before taking images of the vulvae. All images were assembled using Helicon Focus 6.7.1 software.
All measurements are in millimeters. Leg formula, spination, and measurements of palp and legs follow Jäger and Vedel (2007) . Arising points of tegular appendices (i.e. embolus, conductor) are given as ‘clock positions’ on the left palp in ventral view. When the left palp is lost or incomplete, the images of right palp will be taken and flipped horizontally for the sake of comparison. In this case, the right palp will be treated as the left one.
Abbreviations used in the text and figures are given below:
All material studied are deposited in the Institute of Zoology, Chinese Academy of Sciences (IZCAS) in Beijing, China.

Types are deposited in the Institute of Zoology, Chinese Academy of Sciences (IZCAS) in Beijing. All specimens collected were preserved and observed in a 95% ethanol solution. The specimens were measured and examined under a Leica M205C stereomicroscope, and further morphological details were observed using an Olympus BX41 compound microscope. The male palp was dissected from the left side of the spider for further examination. The carapace measurements include the clypeus (except for Relictocera sp. which has a distinct clypeus). The length and width ratios were measured according to the length of the cymbium (including the cymbial protrusion) to its width. The internal genitalia of the female and the male palp were dissected and immersed in lactic acid for digestion. An Olympus C7070 wide zoom digital camera (7.1 megapixels) mounted on an Olympus SZX12 stereomicroscope was used to take photos at different focal plans. The photos were assembled with the image stacking software Helicon Focus 6.7.1 to generate high quality photos before further editing with Adobe Photoshop CC 2014. Leg measurements are given as total length (femur, patella, tibia, metatarsus, and tarsus). Leg segments were measured from their retrolateral side. All measurements are given in millimetres (mm). Terminology follows Li et al. (2014) (link), Tong and Li (2007) , and Deeleman-Reinhold (1995) .