Total nf κb

Another experiment was set up in similar conditions, protein and total RNA was extracted for western blot and quantitative real-time PCR respectively, using TRIzol reagent (Invitrogen, Grand Island, NY, USA) [43 ]. 25μg protein for each lysate was subjected to SDS-PAGE as per our standardized protocol [43 , 44 (link)] with specific primary antibodies (Cell signaling, Danvers, MA, USA) for phospho NF-κB p65 (Cat.#3033), total NF-κB (Cat.#8242), TrkA (Santa Cruz Biotechnology, Dallas, TX, USA, Cat.# sc-118), p75-NTR (Cat.# 2693), α-tubulin (Cat.#2125), and bands were analyzed using Image J software (NIH). Real-time PCR was conducted with extracted total cellular RNA using SYBR green (Qiagen, Valencia, CA, USA) and specific primers for IL1B (Forward: 5’TTCGACACATGGGATAACGA3’ Reverse: 5’TCTTTCAACACGCAGGACAG3’), CASP1 (Forward:5’TACAGAGCTGGAGGCATTTG3’ Reverse: 5’GATCACCTTCGGTTTGTCCT3’), NLRP1 (Forward: 5’TGCCTCACTCCTCTACCAAG3’ Reverse: 5’AATTCCTGACGTTTCATCCA3’), NLRP3 (Forward: 5’GAAGAGGAGTGGATGGGTTT3’ Reverse: 5’CGTGTGTAGCGTTTGTTGAG3’), and RN18S1 (Forward: 5’ TCAAGAACGAAAGTCGGAGG3’ Reverse: 5’GGACATCTAAGGGCATCACA3’). Analysis of relative gene expression was performed as described in earlier publications [43 , 45 (link)].

Total proteins were extracted from BMM under previously described culture conditions using a radioimmunoprecipitation assay buffer (RIPA) buffer (Cell Signaling Technology, Danvers, MA, USA) and quantified using bicinchoninic acid (BCA) protein assay (Thermo Fisher Scientific, Rockford, IL, USA). Equal amounts of each protein sample were loaded onto 10% sodium dodecyl sulfate-polyacrylamide gel and then were transferred onto polyvinylidene fluoride membranes (Millipore, Burlington, MA, USA) for performing the Western blot using specific antibodies. The following antibodies used in the present study were purchased from Santa Cruz Biotechnology (Dallas, TX, USA): MMP-2 (sc-13595), MMP-9 (sc-13520), total-NF-κB (sc-8008), TRAF6 (sc-8409), c-fos (sc-8047), NFATc1 (sc-7294), cathepsin K (sc-4835), IL-1β (sc-52012), IL-17 (sc-374218), RANKL (sc-377079), RNAK (sc-374360), and β-actin (sc-8432). The following antibodies used in the present study were purchased from Cell Signaling Technology (Danvers, MA, USA): phospho-NF-κB (#3036), COX-2 (#12282), iNOS (#13120S), TNFα (#3707), and IL-6 (#12912). The immunoreactive bands visualized by the ECL system (Thermo Fisher Scientific, Rockford, IL, USA) were imaged using MicorChemi 4.2 (Dong-Il Shimadzu Corp., Seoul, Korea).