Typhoon laser imager

To load CMG onto the substrate without unwinding, 50 nM CMG was incubated with 2 nM fork DNA in a buffer containing 25 mM HEPES‐KOH (pH 7.6), 100 mM potassium glutamate, 50 mM magnesium acetate, 0.005% (v/v) Tween‐20, 1 mM TCEP, 200 µg/ml BSA, 0.1 mM AMP‐PNP for 5 min at 37°C. 5 mM ATP (or equal volume of water in ‐ATP reaction) and 80 nM trap oligo were added to initiate the reactions. The reactions were stopped after 15‐min incubation at 37°C with a buffer containing 0.1% SDS, 10 mM EDTA, 5% glycerol, 10 U/ml Proteinase K and bromophenol blue. The reactions were run on 10% TBE PAGEr Gold Precast Gels (Lonza) at 170 V for 70 min. The gel was imaged on Typhoon laser imager (GE Healthcare).

Primed template was prepared by annealing 500 nM oligonucleotide (sequence: 5′‐GAATAATGGAAGGGTTAGAACCTACCAT) to 50 nM M13mp18 ssDNA (New England Biolabs) in 10 mM Tris–HCl pH 7.6, 100 mM NaCl and 5 mM EDTA. The mixture was heated to 75°C and gradually cooled to room temperature. Unannealed oligonucleotide was removed using S400 column (GE Healthcare). The primer extension reaction was performed at 37°C in a buffer containing 25 mM HEPES‐KOH (pH 7.6), 100 mM potassium glutamate, 0.01% NP‐40‐S, 1 mM DTT, 10 mM Mg(OAc)₂, 0.1 mg/ml BSA, 3 mM ATP, 400 μM CTP, GTP, UTP, 30 μM dATP, dCTP, dGTP, dTTP, 33 nM α‐[³²P]‐dCTP. 1 nM primed templated was pre‐incubated with 250 nM RPA for 5 min. 20 nM PCNA and 4 nM RFC were added, and the reaction was initiated by the addition of 20 nM Pol ε. Aliquots were removed at the indicated time points and stopped with 50 mM EDTA. Unincorporated nucleotide was removed with illusta MicroSpin G‐50 columns (GE Healthcare), and samples were run on 0.6% alkaline agarose gel at 23 V for 16 h. The gel was fixed with cold 5% trichloroacetic acid and dried onto Whatman paper. The gel was exposed on BAS‐IP MS Storage Phosphor Screen (GE Healthcare), and screen was developed on a Typhoon laser imager (GE Healthcare).