RNA samples extracted from the nasopharyngeal swabs of the healthcare professionals and control groups were evaluated by qRT-PCR, as described by Corman et al. [20 (link)]. Briefly, a reaction of 25 μL of final volume was used, with the following volumes added to the 1x concentrated master mix: 5 μL of sample RNA, 12.5 μL of 2 × reaction buffer, 1 μL of SuperscriptTM III One-Step with PlatinumTM Taq DNA Polymerase (Invitrogen, Darmstadt, Germany), 0.4 mM of each dNTP, 0.4 μL of 50 mM MgSO4 solution (Invitrogen), 1 μg of non-acetylated bovine albumin (Roche), and DEPC-treated water. Primers and probes used were: E-Sarbeco-F (5ʹ ACAGGTACGTTAATAGTTAATAGCGT 3ʹ), E-Sarbeco-R (5ʹ ATATTGCAGCAGTACGCACACA3ʹ), E-Sarbeco-P1 (5ʹ-FAM-ACACTAGCCATCCTTACTGCGCTTCG-BBQ 3ʹ), Rp-SARSr-F (5ʹ GTGARATGGTCATGTGTGGCGG 3ʹ), RdRp-SARSr-R (5ʹ CARATGTTAAASACACTATTAGCATA 3ʹ) and RdRp-SARSr-P1 (5ʹ- FAM-CCAGGTGGWACRTCATCMGGTGATGC-BBQ 3ʹ). The cycling conditions were: 55 °C for 10 min for reverse transcription, followed by 95 °C for 3 min and 40 cycles of 95 °C for 15 s and 58 °C for 30 s. The reactions were performed on Real-time OneStep® equipment (Applied Biosystems, USA).
Superscript 3 one step with platinum taq dna polymerase
Manufactured by Thermo Fisher Scientific
Sourced in Germany
Superscript™ III One-Step with Platinum™ Taq DNA Polymerase is a reverse transcription and PCR amplification enzyme mix for one-step RT-PCR. It combines the reverse transcriptase and DNA polymerase activities in a single enzyme.
Automatically generated - may contain errors
4 protocols using superscript 3 one step with platinum taq dna polymerase
1
qRT-PCR Detection of SARS-CoV-2 from Nasopharyngeal Swabs
2
SARS-CoV-2 N1 Gene RT-qPCR Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The primer and probe used in the PCR reactions were designed according to the Center for Disease Control and Prevention [31 ]. A reaction of 25 μL (final volume) was used, with the subsequent volumes added to the 1× concentrated master mix: 5 μL of sample RNA, 12.5 μL of 2× reaction buffer, 1 μL of SuperscriptTM III One-Step with PlatinumTM Taq DNA Polymerase (Invitrogen, Darmstadt, Germany), 0.4 mM of each dNTP, 0.4 μL of a 50 mM MgSO4 solution (Invitrogen), 1 μg of non-acetylated bovine albumin (Roche), 10 μM of each primer 2019-nCoVN1-F2019-nCoV N1 (5′GACCCCAAAATCAGCGAAAT3′), 2019-nCoVN1-R2019-nCoV N1 (5′TCTGGTTACTGCCAGTTGAATCTG3′), 2019-nCoVN1-P2019-nCoV N1 probe (5′-FAM—ACCCCGCATTACGTTTGGTGGACC– BBQ 3′), and DEPC water. The reaction began at 55 °C for 10 min for reverse transcription, followed by 95 °C for 3 min, 40 cycles of 95 °C for 15 s, and 58 °C for 30 s (7500 Real-Time PCR System, Thermo Fisher Scientific, Waltham, MA, USA).
3
SARS-CoV-2 N1 Gene RT-PCR Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The primer and probe used in PCR reactions were designed according to the sequences published by the Centers for Disease Control and Prevention (CDC, 2020 ). Briefly, a reaction of 25 μL of the final volume was used, with the following volumes added to the 1× concentrated master mix: 5 μL of sample RNA, 12.5 μL of 2 × reaction buffer, 1 μL of Superscript™ III One-Step with Platinum™ Taq DNA Polymerase (Invitrogen, Darmstadt, Germany), 0.4 mM of each dNTP, 0.4 μL of a 50 mM MgSO4 solution (Invitrogen), 1 μg of non-acetylated bovine albumin (Roche), 10 μM of each primer 2019-nCoVN1-F2019-nCoV N1 (5′GACCCCAAAATCAGCGAAAT3′), 2019-nCoVN1-R2019-nCoV N1 (5′TCTGGTTACTGCCAGTTGAATCTG3′) and 2019-nCoVN1-P2019-nCoV N1 probe (5′-FAM – ACCCCGCATTACGTTTGGTGGACC– BBQ 3′) and DEPC water. The reaction occurred in StepOne™ Real-Time PCR System (Thermo Fisher Scientific, Waltham, MA, USA) in the following cycling: 55 °C for 10 min for reverse transcription, followed by 95 °C for 3 min and 40 cycles of 95 °C for 15 s, 58 °C for 30 s.
4
RT-qPCR Detection of SARS-CoV-2 N1 Gene
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The primer and probe used in PCR reactions was designed according to the sequences published by the Centers for Disease Control and Prevention (CDC 2020 ). Briefly, a reaction of 25 μL of final volume was used, with the following volumes added to the 1 × concentrated master mix: 5 μL of sample RNA, 12.5 μL of 2 × reaction buffer, 1 μL of Superscript™ III One-Step with Platinum™ Taq DNA Polymerase (Invitrogen, Darmstadt, Germany), 0.4 mM of each dNTP, 0.4 μL of a 50 mM MgSO4 solution (Invitrogen), 1 μg of non-acetylated bovine albumin (Roche), 10 μM of each primer 2019-nCoVN1-F2019-nCoV N1 (5′GACCCCAAAATCAGCGAAAT3 ′), 2019-nCoVN1-R2019-nCoV N1 (5′TCTGGTTACTGCCAGTTGAATCTG3 ′), 2019-nCoVN1-P2019-nCoV N1 probe (5′-FAM – ACCCCGCATTACGTTTGGTGGACC– BBQ 3′), and DEPC water. The reaction occurred in StepOne™ Real-Time PCR System (Thermo Fisher Scientific, Waltham, MA, USA) in the following cycling: 55 °C for 10 min for reverse transcription, followed by 95 °C for 3 min and 40 cycles of 95 °C for 15 s, 58 °C for 30 s.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!