The total RNA was extracted using TRIzol reagent (Life Technologies, Inc., Waltham, MA, USA). Complementary DNA (cDNA) synthesis was performed using a PrimeScript kit (Takara Biotechnology, Dalian, China), following the manufacturer’s protocol. PCR was conducted using SYBR Green PCR master mix (Applied Biosystems, Foster, CA, USA) on an ABI 9700 real-time PCR system (Applied Biosystem). The following primers were used: RNF7-F: 5′-TGCACTCACCTCACTGTTC-3′, RNF7-R: 5′-CACCTGTAATCCCAGCTACTC-3′; SOCS1-F: 5′-CACGCACTTCCGCACATTCC-3′, SOCS1-R: 5′-GCTGCCATCCAGGTGAAAGC-3′; and GAPDH-F: 5′-AATCCCATCACCATCTTC-3′, GAPDH-R: 5′-AGGCTGTTGTCATACTTC-3′. The 2−ΔΔCT method was used to calculate the fold changes in the mRNA expression levels of RNF7 and SOCS1.
Abi 9700 real time pcr system
Manufactured by Thermo Fisher Scientific
Sourced in United States
The ABI 9700 real-time PCR system is a laboratory instrument designed for quantitative real-time polymerase chain reaction (qRT-PCR) analysis. It is capable of performing real-time monitoring of DNA amplification during the PCR process.
Automatically generated - may contain errors
Lab products found in correlation
10 protocols using abi 9700 real time pcr system
1
qRT-PCR Analysis of RNF7 and SOCS1
2
Quantitative Analysis of Oncogene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the BxPC-3, SW1990, and PANC-1 cells using TRIzol reagent (Life Technologies, Inc., Waltham, MA, USA). cDNA was synthesized using the PrimeScript kit (Takara Biotechnology, Dalian, China) based on the manufacturer’s protocol. The Quantitative RT-PCR using SYBR green PCR master mix (Applied Biosystems, Foster, CA, USA) was performed in an ABI 9700 real-time PCR system (Applied Biosystem). The primers used for PCR are as follows: ARHGAP4-F: 5ʹ-CTACAACCTGGCCGTGTGCTTC-3ʹ, ARHGAP4-R: 5ʹ-CTTCCAGCTCCGGCTCATTGTC-3ʹ; HIF-1α-F: 5ʹ-CTGGCTACAATACTGCACAAAC-3ʹ, HIF-1α-R: 5ʹ-ATGCTACTGCAATGCAATGG-3ʹ; PKM2-F: 5ʹ-AGCAAGAAGGGTGTGAAC-3ʹ, PKM2-R: 5ʹ-CGGATGAATGACGCAAAC-3ʹ; GAPDH-F: 5ʹ-AATCCCATCACCATCTTC-3ʹ, GAPDH-R: 5ʹ-AGGCTGTTGTCATACTTC-3ʹ. The fold changes of ARHGAP4, HIF-1α, and PKM2 mRNA were determined by the 2−ΔΔCT method.
3
Quantitative Analysis of RNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using a TRIzol reagent (Life Technologies, Inc., Waltham, MA, USA). cDNA was synthesized using a PrimeScript kit (Takara Biotechnology, Dalian, China). Quantitative RT‐PCR was performed in an ABI 9700 real‐time PCR system (Applied Biosystem). The primers were shown as follows: METTL14: F‐5’‐CTGGGAATGAAGTCAGGATAG‐3′, R‐5’‐CCAGGGTATGGAACGTAATAG‐3′; TRIM27: F‐5’‐TGCCATCACCCAGTTCTC‐3′, R‐5’‐AGCCCTGCTCAATGTGTC‐3′; IGF2BP2: F‐5’‐CGGGAGCAAACCAAAGACC‐3′, R‐5’‐GCAAACCTGGCTGACCTTC‐3′; GAPDH: F‐5’‐AATCCCATCACCATCTTC ‐3′, R‐5’‐AGGCTGTTGTCATACTTC‐3′.
4
Quantifying ARHGAP6 mRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
16HBE, A549 and A549/DDP cells were seeded at 5 × 105 cells/well in six-well plates and grown for one day at 37°C and 5% CO2. Cells were transduced with or without the relevant vector, and 48 hours later, total RNA from these cell lines was extracted using TRIzol reagent (Life Technologies, Inc., Waltham, MA, USA) according to the manufacturer’s instruction. Similarly, TRIzol reagent was also used to extract total RNA from the lung adenocarcinomas tissues as mentioned above. Following the manufacturer’s protocol, the PrimeScript kit (Takara Biotechnology, Dalian, China) was used to synthesize cDNA. qPCR was performed in an ABI 9700 real-time PCR system (Applied Biosystem) using SYBR green PCR master mix (Applied Biosystems, Foster, CA, USA). The primers used are as follows: ARHGAP6-F: 5ʹ-GAATTTGACCGTGGGATTG-3ʹ, ARHGAP6-R: 5ʹ-CAGGGAGGTAGAAGGTATATG-3ʹ; GAPDH-F: 5ʹ-AATCCCATCACCATCTTC-3ʹ, GAPDH-R: 5ʹ-AGGCTGTTGTCATACTTC-3ʹ. The fold changes of mRNA were determined by the 2−ΔΔCT method.
5
Quantifying FAM46B and LDHA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
TRIzol reagent (Life Technologies, Inc., Waltham, MA, USA) was used to extract RNA from prostate cancer tissues and cell lines. cDNA was produced from RNA via PrimeScript kit (Takara Biotechnology, Dalian, China) following the manufacturer’s protocol. SYBR green quantitative RT-PCR was performed in an ABI 9700 real-time PCR system (Applied Biosystem) using standard reagents (Applied Biosystems, Foster, CA, USA). The primers used for the PCR are as follows: FAM46B-F: 5ʹ-CTGGCTGCCTTGTAACTG-3ʹ, FAM46B-R: 5ʹ-TCGGGAAAGTCTGGTCTG-3ʹ; LDHA-F: 5ʹ-AGCCCGATTCCGTTACCTAATG-3ʹ, LDHA-R: 5ʹ-ACCTGCTTGTGAACCTCTTTCC-3ʹ; GAPDH-F: 5ʹ-AATCCCATCACCATCTTC-3ʹ, GAPDH-R: 5ʹ-AGGCTGTTGTCATACTTC-3ʹ. Fold change of FAM46B and LDHA mRNA was determined by the 2−ΔΔCT method.
6
RNA Extraction, cDNA Synthesis, and QPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using TRIzol reagent (Invitrogen, USA) and the cDNA was synthesized by using a PrimeScript kit (Takara Biotechnology, Dalian, China). The Quantitative RT-PCR using SYBR green PCR master mix (Applied Biosystems, Foster, CA, USA) was performed in an ABI 9700 real-time PCR system (Applied Biosystem). Gene expression was normalized to GAPDH. The applied primer sequences were: NLRP3-F: 5ʹ-ATGTGGGGGAGAATGCCTTG-3ʹ; NLRP3-R: 5ʹ-TTGTCTCCGAGAGTGTTGCC-3ʹ; GAPDH-F: 5ʹ-AATCCCATCACCATCTTC-3ʹ; and GAPDH-R: 5ʹ-AGGCTGTTGTCATACTTC-3ʹ. We determined mRNA fold-changes using the 2−ΔΔCT method.
7
Quantification of Viral RNA and DNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Viral RNA (vRNA) was isolated from plasma using a QIAamp viral RNA mini kit (Qiagen, Valencia, CA, United States). Total viral DNA (vDNA) was extracted from monkey peripheral blood mononuclear cells (PBMCs) using a QIAamp Blood DNA mini kit (Qiagen, Valencia, CA, United States) as previously reported (Chong et al., 2019 (link)). Viral RNA was subjected to quantitative real-time reverse transcription-PCR (qRT-PCR) on an ABI 9700 real-time PCR system (Applied Biosystems) using the following primers and probe: Gag91 forward primer: 5′–GCA GAG GAG GAA ATT ACC CAG TAC–3′; Gag91 reverse primer: 5′–CAA TTT TAC CCA GGC ATT TAA TGT T–3′; Probe: 5′-(FAM)-ACC TGC CAT TAA GCC CGA—(MGB)-3′. The copy numbers were estimated by comparison to a pGEM-SIV gag477 standard curve. The limits of detection were 100 copy equivalents of RNA or DNA per ml of plasma. Triplicate test reactions were performed for each sample.
8
Quantitative Analysis of Deubiquitinase Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using Trizol reagent (Invitrogen) and the cDNA was synthesized by using a PrimeScript kit (TaKaRa, Dalian, China). RT-PCR was performed using SYBR green PCR master mix (Applied Biosystems, Foster City, USA) in an ABI 9700 real-time PCR system (Applied Biosystems). Fold-changes of mRNA expression were determined using the 2
−ΔΔCT method, and normalized to that of
GAPDH. Primer sequences are listed in
Table 1 .
−ΔΔCT method, and normalized to that of
GAPDH. Primer sequences are listed in
Gene | Primer sequence (5′→3′) | |
USP1 | Forward Reverse | GATTATTTGCGGTTGTGATGC CATTCAATGGTTCTGGCTTACC |
USP4 | Forward Reverse | CTACTTTGGTTTGCCCAGAATG AGAGCCTCGCACAGGTCGG |
USP7 | Forward Reverse | ATGATGTTCAGGAGCTTTGTCG CCCCAGCGTCGTATTTATTGTC |
USP14 | Forward Reverse | CGAGAAAGGTGAACAAGGACAG TGCCGATGCAGATGAGGAG |
USP15 | Forward Reverse | GACGCTGCTCAAAACCTCG CTCCCATCTGGTATTTGTCCC |
USP20 | Forward Reverse | TGCGGAACGGAGTGAAGTAC AAGGAGACGTGGCTGTTGATC |
USP25 | Forward Reverse | ACACCCCACCAGAAACCG CCTATAATCCTGATGCCACTCC |
USP47 | Forward Reverse | TTTGCTACCTGAACAATCCCC GCTGCTGTCCCCATTATCTCC |
p53 | Forward Reverse | CCCCTCCTCAGCATCTTATCC ACAAACACGCACCTCAAAGC |
GAPDH | Forward Reverse | AATCCCATCACCATCTTC AGGCTGTTGTCATACTTC |
9
Quantitative Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cells or tissues by TRIzol reagent (Life Technologies, United States) and reverse transcribed to cDNA with PrimeScript kit (Takara Biotechnology, China) in accordance with the manufacturers’ protocols. Quantitative real time PCR (Q-PCR) was carried out using SYBR Green PCR Master Mix (Applied Biosystems, United States) on an ABI 9700 real-time PCR system (Applied Biosystems, United States). The primers used were as follows: STK35-F: 5′-CCTGAAGCCAGACAACATCC-3′, STK35-R: 5′-GT CTTGATTGCCCTCTTTGC-3′; NEDD4L-F: 5′-CTCGGTGAT GTGGATGTG-3′, NEDD4L-R: 5′-TTCGGCGTCCATGAGTA G-3′; and β-actin-F: 5′-TGGCATCCACGAAACTAC-3′, β-actin-R: 5′-CTTGATCTTCATGGTGCTG-3′. The fold changes at the transcript level were GAPDH-normalized and calculated based on the 2–ΔΔCT method.
10
Quantitative PCR for CRC Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from CRC tissues and cell lines using TRIzol reagent (Life Technologies) and reverse transcribed into cDNA with PrimeScript kit (Takara Biotechnology, Dalian, China) according to the manufacturers' instructions. Quantitative PCR was conducted using SYBR green PCR master mix (Applied Biosystems, Foster, CA, USA) on ABI 9700 real-time PCR system (Applied Biosystems). The following primers were used: RNF180-F: 5′-AGT TAC AAG AAG GCA GTT CC-3′, RNF180-R: 5′-AAT CCA ATG ACC CAG TTC AC-3′; WISP1-F: 5′-GGA TTG TCT GGC AGT AGC C-3′, WISP1-R: 5′-GAA GCA GTC AGC CCT TAT G-3′; GAPDH-F: 5′-AAT CCC ATC ACC ATC TTC-3′, GAPDH-R: 5′-AGG CTG TTG TCA TAC TTC-3′. The fold changes of mRNA were calculated and normalized to GAPDH with 2−ΔΔCT method.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!