Pgl3 basic firefly luciferase reporter vector

Various B7–H4 promoter fragments were synthesized and cloned into the pGL3-basic firefly luciferase reporter vector (Promega, Madison, WI, USA). Briefly, cells were seeded in 24-well plates for 24 h and transfected in triplicates with 0.5 μg of each experimental plasmid and 0.5 μg of the Renilla pRL-TK plasmid (used as a control) per well using Lipofectamine 3000, following the manufacturer's protocol. A dual-luciferase reporter assay (Promega) was performed to measure the relative luciferase activity 24 h after transfection. Relative light units (RLUs) from the firefly luciferase signals were normalized with the RLUs from Renilla luciferase signals.

The PIRH2 promoter region of a 1295-bp DNA fragment (−948 to +300) containing all three putative AREs for NRF2 (ARE1, −847; ARE2, +77; and ARE3, +324) was cloned into the pGL3-basic firefly luciferase reporter vector (Promega, Madison, WI, USA) at restriction sites Nhe I and Xhol. Primers to amplify the DNA fragment by PCR were 5′ CACGCTAGCGCTGTGTACCCCGAGTATGA 3′ and 5′ GACTCGAGGAGACCACTGTGCAAGCCTA 3′. The PIRH2 promoter region with the same 1295-bp DNA fragment (−948 to +300), except for a mutation on putative ARE3 as indicated, was also cloned into the pGL-3 basic firefly luciferase vector using the same restriction sites. Primers to amplify the DNA fragment by PCR were 5′ CACGCTAGCGCTGTGTACCCCGAGTATGA 3′ and 5′ GACTCGAGGAGACCACTGTGCAATACTAAAATCTTCCCAAGAAGG 3′. The mutation on putative ARE3 was incorporated into the reverse primer as described above. Luciferase reporter assays were performed following the manufacturer’s protocol. Briefly, the reporter vectors or control pGL-3 vector together with a Renilla luciferase vector were cotransfected into NRF2-expressing or control HEK293T cells as indicated. After 24 hours of incubation, the luciferase activity was determined using a Dual Luciferase Assay (Promega). The activity of firefly luciferase reporter was normalized by that of Renilla luciferase of each sample.

The mouse Tgfbr2 promoter (702 bp, from −650 to +52 relative to the transcription start site) was amplified from genomic DNA of E0771GFP cells by PCR using Q5 Hot Start High-Fidelity 2X Master Mix (NEB). The Tgfbr2 promoter fragment was cloned into the Kpn I and Hind III restriction sites of the pGL3-Basic firefly luciferase reporter vector (Promega). A mutant Tgfbr2 promoter where putative ZBTB18 binding sites (5′-[AC]ACATCTG[GT][AC]-3′) are substituted with two Sma I binding sites (5′-CCCGGGCCCGGG-3′) was generated by cloning a gBlock into the Kpn I and Hind III restriction sites of the pGL3-Basic firefly luciferase reporter vector. 293FT cells were plated in 96-well plates at 10⁴ cells per well. After 24 hours, cells were cotransfected with 75 ng of luciferase reporter plasmid (pGL3-Basic, pGL3-Tgfbr2 promoter, or pGL3-mutant Tgfbr2 promoter); 75 ng of expression plasmid ZBTB18OE, ZBTB18-Nucl, ZBTB18-Cyto, or empty expression vector (EV); and 50 ng of pRL-TK Renilla luciferase vector (to normalize for transfection efficiency; Promega) using TransIT-293 reagent in Opti-MEM I. After 24 hours, luciferase activity was measured using the Dual-Glo Luciferase Assay System (Promega). Firefly luciferase values were normalized to Renilla luciferase values and protein content and reported relative to the EV condition.