Geneart genomic cleavage detection kit

Manufactured by Thermo Fisher Scientific

Sourced in United States

The GeneArt Genomic Cleavage Detection Kit is a laboratory tool designed for the detection and analysis of genomic cleavage events. It provides a reliable method for identifying and quantifying gene editing outcomes in cell lines and samples.

Automatically generated - may contain errors

Lab products found in correlation

72 protocols using geneart genomic cleavage detection kit

CRISPR-mediated CCTβ disruption in U2OS and Huh7

Check if the same lab product or an alternative is used in the 5 most similar protocols

CCTβ in U2OS and Huh7 was disrupted according to the standard protocol^{66 (link)}. Nucleotide sequences (467–486 for U2OS and 429–448 for Huh7) in PCYT1B mRNA (Accession No. NM_004845.5) that are commonly used for CCTβ2 and CCTβ3 were selected using web-based prediction software (Crispr direct; http://crispr.dbcls.jp)^{67 (link)} and transcribed with a MEGAshortscript T7 Transcription Kit (Thermo Fisher). Cells were co-transfected with the in vitro-transcribed guide RNA and GeneArt CRISPR Nuclease mRNA (Thermo Fisher) using Lipofectamine Messenger MAX (Thermo Fisher) and examined for genome digestion by GeneArt Genomic Cleavage Detection Kit (Thermo Fisher) 2 days after transfection. Clones obtained by single-cell cloning were checked by DNA sequencing to confirm genome editing and western blotting.

Ogasawara Y., Cheng J., Tatematsu T., Uchida M., Murase O., Yoshikawa S., Ohsaki Y, & Fujimoto T. (2020). Long-term autophagy is sustained by activation of CCTβ3 on lipid droplets. Nature Communications, 11, 4480.

+ Open protocol

+ Expand

Genome DNA Extraction and Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genome DNA was extracted from A431 cells (wild type, clones #1 and #2) using GeneArt Genomic Cleavage Detection Kit (Thermo Fisher Scientific), following the manufacturer’s protocol. The sequence around the target of CRISPR/Cas9 was amplified using the following pair of primers: Piezo1 gDNA forward and Piezo1 gDNA reverse (Table S5). The amplified product was purified using Wizard SV Gel and PCR Clean-up system (Promega) and inserted into T-Vector pMD20 (Takara Bio) using DNA Ligation Kit (Takara Bio) according to the manufacturer’s protocol. The ligation mixture was introduced into Escherichia coli DH5α and the insert sequence was verified by standard sequencing.

Kuriyama M., Hirose H., Masuda T., Shudou M., Arafiles J.V., Imanishi M., Maekawa M., Hara Y, & Futaki S. (2022). Piezo1 activation using Yoda1 inhibits macropinocytosis in A431 human epidermoid carcinoma cells. Scientific Reports, 12, 6322.

+ Open protocol

+ Expand

CRISPR-mediated knockout of ELAVL4 in iPSCs

Check if the same lab product or an alternative is used in the 5 most similar protocols

single guide RNAs targeting exons common to all human ELAVL4 splicing isoforms were designed using the Broad CRISPR design tool (https://portals.broadinstitute.org/gpp/public/analysis-tools/sgrna-design) (figure 1A). The top three sgRNAs were cloned into the pXPR-003 (Addgene #52963) backbone and transfected with SpCas9 plasmid (Addgene #78166) into M17D cells using FuGENE HD (Promega) to assess sgRNA knockdown (KD) efficiency by qPCR. The most efficient M17D KD of ELAVL4 was observed using sgRNA B1, which was subsequently co-transfected with SpCas9 into fAD and fAD^corr iPSCs using Lipofectamine2000. Two days post-transfection, iPSCs were selected with puromycin (5 μg/ml) and blasticidin (4 μg/ml) for enrichment. Editing efficiency in the resulting polyclonal lines was assessed with the GeneArt Genomic Cleavage Detection Kit (ThermoFisher). Monoclonal cell lines were obtained by limiting dilution and examined by sequencing over the sgRNA target region. After monoclonal selection, the cellular karyotype was assessed using the NanoString nCounter CNV codeset and visualized using copy number package in R (Nilsen et al., 2012 (link)).

van der Linden R.J., Gerritsen J., Liao M., Widomska J., Pearse RV I.I., White F.M., Franke B., Young-Pearse T.L, & Poelmans G. (2022). RNA-binding protein ELAVL4/HuD ameliorates Alzheimer’s disease-related molecular changes in human iPSC-derived neurons. Progress in neurobiology, 217, 102316.

+ Open protocol

+ Expand

Genomic DNA Cleavage Detection

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genomic DNA from at least 5x10⁴ GFP+ cells was isolated and amplified using the GeneArt Genomic Cleavage Detection Kit (Thermo Fisher Scientific; see Table S2 for primer sequences). Cleavage assays were performed as per the manufacturer’s protocol. Images were acquired using the Bio-Rad Gel Doc XR+ system and the Image Lab software. Non-overlapping PCR products were pooled for sequencing. CRISPResso tool was utilized to analyze indels generated by select sgRNAs (Pinello et al., 2016 (link)).

Factor D.C., Barbeau A.M., Allan K.C., Hu L.R., Madhavan M., Hoang A.T., Hazel K.E., Hall P.A., Nisraiyya S., Najm F.J., Miller T.E., Nevin Z.S., Karl R.T., Lima B.R., Song Y., Sibert A.G., Dhillon G.K., Volsko C., Bartels C.F., Adams D.J., Dutta R., Gallagher M.D., Phu W., Kozlenkov A., Dracheva S., Scacheri P.C., Tesar P.J, & Corradin O. (2020). Cell-Type-Specific Intralocus Interactions Reveal Oligodendrocyte Mechanisms in MS. Cell, 181(2), 382-395.e21.

+ Open protocol

+ Expand

Engineered THP1 cells for TREM2 knockout

Check if the same lab product or an alternative is used in the 5 most similar protocols

A THP1 derivative that stably expresses Cas9 (THP1-CAS9) was generated using a lentiviral construct (Addgene, lentiCas9-Blast, #52962) after blasticidin selection. Single guide RNAs (sgRNAs) for targeting TREM2 were selected using the online CRISPR design tool (crispr.mit.edu) (24 (link)). THP1-CAS9 cells were nucleofected with sgRNAs using a protocol recommended for THP1 (Lonza, Amaxa 4D Nucleofector, Protocol #292). Cutting efficiency for each guide was measured using GeneArt Genomic Cleavage Detection Kit (ThermoFisher, #A24372). Based on % indel efficiency, sgRNA within exon 2 (sense: ACTGGTAGAGACCCGCATCA) was chosen for subsequent experiments. TREM2-negative cells were enriched by cell sorting after the immunostaining of live cells. Colonies grown from single sorted cells were sequenced; clones with frame-shifting indel mutations inactivating all TREM2 alleles were tested for the absence of protein by Western blotting.

Korvatska O., Kiianitsa K., Ratushny A., Matsushita M., Beeman N., Chien W.M., Satoh J.I., Dorschner M.O., Keene C.D., Bammler T.K., Bird T.D, & Raskind W.H. (2020). Triggering Receptor Expressed on Myeloid Cell 2 R47H Exacerbates Immune Response in Alzheimer’s Disease Brain. Frontiers in Immunology, 11, 559342.

+ Open protocol

+ Expand

CRISPR-Cas9 Mediated Indel Analysis in Neuro-2a Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Neuro-2a (N2a) cells (ATCC^® CCL131^™) were cultured in Dulbecco’s modified Eagle’s medium (Sigma-Aldrich, Cat# D8437) supplemented with 10% Fetal Bovine Serum (Thermo Fisher, Cat# 16000044), 500 ug/ml penicillin-streptomycin-Glutamine (Thermo Fisher, Cat# 10378016) at 37°C with 5% CO₂. Cells were routinely tested for mycoplasma using PCR detection kit (ATCC^® 30-1012K^™) Indel analysis was performed with the GeneArt Genomic Cleavage Detection Kit (Thermo Fisher, Cat# A24372). Briefly, the U6-sgLepR cassette was cloned into the pCas9-GFP backbone (Addgene, Cat# 44719) following MluI (New England Biolabs, Cat# R3198S) digestion. Cells were transfected with Lipofectamine^™ 3000 (Thermo Fisher, Cat#L3000008) and fluorescent GFP was used to assess the transfection efficiency after 48 hours. Genomic DNA was extracted and PCR amplification was performed by using the following primers, Lepr on-target primer fwr: cttctctggaaggtagacgctc; rev: gaccttgctcattcccaaag. Gpr108 off-target fwr: tgagagtcagccggtggata; rev: atgcttcgttgcacggatct. PCR products were digested with Detection Enzyme and analyzed with DNA gel electrophoresis. Cleavage efficiency was calculated as: Cleavage Efficiency= 1− [(1− fraction cleaved)^1/2]. Fraction Cleaved= sum of cleaved band intensities/(sum of the cleaved and parental band intensities).

Xu J., Bartolome C.L., Low C.S., Yi X., Chien C.H., Wang P, & Kong D. (2018). Genetic identification of leptin neural circuits in energy and glucose homeostases. Nature, 556(7702), 505-509.

+ Open protocol

+ Expand

Optimization of CRISPR-Cas9 Electroporation

Check if the same lab product or an alternative is used in the 5 most similar protocols

The electroporation parameters were optimized by transfecting adipose tissue-derived preadipocytes with sgRNA targeting the human hypoxanthine phosphoribosyltransferase (HPRT) (Thermo Fisher, Cat no: A35524) locus and Cas9 protein using a combination of different voltage and number of pulses (Supplementary Table 1). HPRT is a housekeeping gene and a commonly used control. The genome-editing efficiency was tested by analyzing the locus-specific cleavage of genomic DNA using GeneArt® Genomic Cleavage Detection Kit (Thermo Fisher). The details are given in the supplementary text (Supplementary Fig. 1). The optimal voltage, pulse width, and pulse number were 1750 Volts, 20 milliseconds, and 1, respectively to knock out FKBP5 and PPARG genes.

Kamble P.G., Hetty S., Vranic M., Almby K., Castillejo-López C., Abalo X.M., Pereira M.J, & Eriksson J.W. (2020). Proof-of-concept for CRISPR/Cas9 gene editing in human preadipocytes: Deletion of FKBP5 and PPARG and effects on adipocyte differentiation and metabolism. Scientific Reports, 10, 10565.

+ Open protocol

+ Expand

CRISPR-Cas9 Knockouts of Key Signaling Proteins

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

RIG-I, STING, STAT2, and p65 CRISPR-Cas9 KO cell lines were performed by transfection with Lipofectamine CRISPRMAX of TrueGuide Synthetic CRISPR gRNA and TrueCut Cas9 Protein v2 according to the manufacturer’s instructions (Thermo Fisher Scientific). CRISPR gene-editing efficiency was verified using GeneArt Genomic Cleavage Detection kit (A24372; Thermo Fisher Scientific). MAVS KO cell lines were performed by transfection of the pSpCas9(BB)-2A-Puro (PX459) plasmid containing MAVS gRNAs with FuGENE 6 Transfection Reagent (E2691; Promega). Sixteen hours after transfection, cells were selected with puromycin (1 μg/ml) for 2 days. IRF3 KO cell lines were performed by transfection of the pU6-(BbsI)-CBh-Cas9-T2A-mCherry plasmid containing IRF3 gRNAs with FuGENE 6 Transfection Reagent (E2691; Promega). Twenty-four hours after transfection, mCherry-expressing cells were single cell-sorted into 96-well plates. MCF10A IRF3 KO and MCF10A p53 KO cell lines was created as previously described^{66 ,84 (link)}. For every target, three or more independent clones were generated. gRNA sequences used in this study are listed in Supplementary Table 2.

Oh S., Bournique E., Bowen D., Jalili P., Sanchez A., Ward I., Dananberg A., Manjunath L., Tran G.P., Semler B.L., Maciejowski J., Seldin M, & Buisson R. (2021). Genotoxic stress and viral infection induce transient expression of APOBEC3A and pro-inflammatory genes through two distinct pathways. Nature Communications, 12, 4917.

+ Open protocol

+ Expand

CRISPR-Cas9 Mediated Gene Editing in CHOZN Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

CHOZN® cells (GS^−/− CHOK1, Sigma) were passaged regularly in EX‐Cell CD CHO Fusion medium (Sigma 14365C) containing 6 mM Glutamine. Per gRNA transfection, 1ug TrueCut Cas9 V2 proteins (Thermo Fisher A36496), 200 ng CRISPR IVT gRNA (Table 1), and 10 pmol ss‐Oligos (Table 1) in 10ul reaction volume were electroporated into 3.0E + 6 cells using NEON electroporator, following the optimized parameters of 1,600 V pulse voltage, 10 ms each pulse for three pulses. In 72 hr posttransfection, a portion of transfection cells were processed for the estimation of gene editing efficiency using GeneArt genomic cleavage detection kit (Thermo Fisher A24372). The rest of cells were cultured to expand for stable pool generation. The pools of highest editing efficiency were single cell sorted into 10 plates of 96‐well plates. Once confluent, the clones were consolidated to one 96‐well plate and gRNA‐targeted genomic regions were polymerase chain reaction (PCR) amplified (Table 1) and sequenced with next generation sequencing.

Liu W., Padmashali R., Monzon O.Q., Lundberg D., Jin S., Dwyer B., Lee Y., Korde A., Park S., Pan C, & Zhang B. (2020). Generation of FX −/− and Gmds −/− CHOZN host cell lines for the production of afucosylated therapeutic antibodies. Biotechnology Progress, 37(1), e3061.

+ Open protocol

+ Expand

CRISPR-Cas9 Indel Mutation Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Since gRNA_VEGFA1 was designed as described (37 (link)), we selected the on-target site and off-target sites (OT-1, OT-2 and OT-3) that were reported to have the highest DSB scores (37 (link)) for indel mutation analysis. The frequency of indel mutations was analyzed by mismatch cleavage assay using the GeneArt^® Genomic Cleavage Detection Kit (Thermo Fisher Scientific) following the manufacturer's instructions. Briefly, the genomic DNA was extracted by Cell Lysis buffer (Thermo Fisher Scientific) and the loci where the DSB occurred were amplified by PCR using the AmpliTaq Gold 360 Master Mix (Thermo Fisher Scientific) with specific primers (Supplementary Table S1). The PCR amplicons were denatured and re-annealed, followed by digestion with the Detection Enzyme (Thermo Fisher Scientific). The resultant DNA fragments were analyzed by 2% TBE agarose gel electrophoresis and stained by ethidium bromide. The band intensities were determined by scanning densitometry using ImageJ and the frequencies of indel mutation were calculated following the manufacturer's instructions. All the indel mutation frequency data were subtracted from that of the control group (the cells co-transfected with pCLY and pTA-gϕ).

Shen C.C., Hsu M.N., Chang C.W., Lin M.W., Hwu J.R., Tu Y, & Hu Y.C. (2018). Synthetic switch to minimize CRISPR off-target effects by self-restricting Cas9 transcription and translation. Nucleic Acids Research, 47(3), e13.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!