Log In Sign up
The largest database of trusted experimental protocols

Anti cgas

Manufactured by Cell Signaling Technology
Visit Supplier
Sourced in United States, France

Anti-cGAS is a primary antibody product developed by Cell Signaling Technology. It recognizes the cGAS protein, a crucial component of the innate immune response. The antibody can be used to detect and study the cGAS protein in various experimental applications.

Automatically generated - may contain errors

Lab products found in correlation

Anti sting, by Cell Signaling Technology (11 mentions) Anti irf3, by Cell Signaling Technology (9 mentions) Anti tbk1, by Cell Signaling Technology (8 mentions) Anti phospho irf3, by Cell Signaling Technology (6 mentions) Anti phospho tbk1, by Cell Signaling Technology (6 mentions) Anti mavs, by Cell Signaling Technology (4 mentions) Anti p irf3, by Cell Signaling Technology (4 mentions) Anti flag, by Merck Group (4 mentions) Anti rig 1, by Cell Signaling Technology (3 mentions) Anti p tbk1, by Cell Signaling Technology (3 mentions) Anti β actin, by Merck Group (3 mentions) Anti phospho sting, by Cell Signaling Technology (2 mentions) Ab184990, by Abcam (2 mentions) Ab11316, by Cell Signaling Technology (2 mentions) Enhanced chemiluminescence, by Cytiva (2 mentions) Sds page, by Thermo Fisher Scientific (2 mentions) Anti mda5, by Cell Signaling Technology (2 mentions) Anti β actin, by Cell Signaling Technology (2 mentions) Anti isg15 h 150, by Santa Cruz Biotechnology (2 mentions) Anti isg56, by Cell Signaling Technology (2 mentions)

Close spelling variants of this product

Rabbit anti-cGAS (13 citations) Rabbit monoclonal anti-cGAS (4 citations) Anti-cGAS antibody (3 citations) Anti-cGAS (D1D3G, (2 citations) Anti-cGAS (clone D1D3G, (2 citations)

29 protocols using anti cgas

1

Comprehensive Antibody Characterization Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
The following antibodies were used: anti-cGAS (#31659), anti-cGAS (#83623), anti-TBK1 (#3013), anti-phospho-TBK1 (#5483), anti-IRF3 (#4302), anti- phospho-IRF3 (#4947), anti-Myc (#2276) were purchased from Cell Signaling Technology; anti-VSV-G (V5507), anti-MB21D2 (SAB2108874) were purchased from Sigma-Aldrich; anti-Flag (PA1-984B) was purchased from Thermo Fisher Scientific; anti-HA (sc-7392), anti-Actin (sc-58673) were purchased from Santa Cruz Biotechnology; FITC anti-mouse CD3 (#100203), PE anti-mouse IFN-γ (#505807), APC anti-mouse Perforin (#154403), PE/Cy7-anti-mouse CD80 (#104733), PerpCP/Cyanine5.5 anti-mouse CD86 (#105027), FITC anti-mouse CD11c (#117305) were purchased from BioLegend; PE anti-mouse CD62L (#561918), PerCP-Cy5.5 anti-mouse CD8α (#561109), APC anti-mouse CD69 (#560689), PE/Cyanine7 anti-human/mouse Granzyme B (#372213) were purchased from BD Biosciences; APC anti-mouse-MHC class II (ab93559) was purchased from Abcam. All antibodies were used according to the manufacturer’s instructions. 2′, 3′-cGAMP was purchased from InvivoGen. For Biotin Pull-Down assay, Streptavidin-Agarose (S1638, Sigma-Aldrich) was used.
Liu H., Yan Z., Zhu D., Xu H., Liu F., Chen T., Zhang H., Zheng Y., Liu B., Zhang L., Zhao W, & Gao C. (2023). CD-NTase family member MB21D2 promotes cGAS-mediated antiviral and antitumor immunity. Cell Death and Differentiation, 30(4), 992-1004.
+ Open protocol
+ Expand
2

Quantitative Immunoblotting and Immunofluorescence

Check if the same lab product or an alternative is used in the 5 most similar protocols
Primary antibodies used were anti-γH2AX (#2577, Cell Signaling), anti-GAPDH (MAB374, Millipore), anti-CAD (PA5-19913, Thermo Fisher), anti-STING (#13647, Cell Signaling), anti-phospho-STING (#19781, Cell Signaling), anti-ICAD (#9732, Cell Signaling), anti-cGAS (#79978, Cell Signaling), anti-E-cadherin (#3195, Cell Signaling) and anti-α-tubulin(T9026, Sigma–Aldrich). Secondary antibodies were (Western blotting) anti-rabbit IgG(H + L)-HRP (A6667, Sigma-Aldrich), anti-mouse IgG(H + L)-HRP (115-035-166, Dianova), (immunofluorescence) anti-mouse IgG(H + L)-Cy5 (715-175-151, Dianova) and anti-rabbit IgG(H + L)-Alexa488 (711-545-152, Dianova).
Haimovici A., Höfer C., Badr M.T., Bavafaye Haghighi E., Amer T., Boerries M., Bronsert P., Glavynskyi I., Fanfone D., Ichim G., Thilmany N., Weber A., Brummer T., Spohr C., Öllinger R., Janssen K.P., Rad R, & Häcker G. (2022). Spontaneous activity of the mitochondrial apoptosis pathway drives chromosomal defects, the appearance of micronuclei and cancer metastasis through the Caspase-Activated DNAse. Cell Death & Disease, 13(4), 315.
+ Open protocol
+ Expand
3

Immunoblotting Assay for Cellular Proteins

Check if the same lab product or an alternative is used in the 5 most similar protocols
For immunoblotting, cells were harvested by trypsinization and lysed in
1x Laemmli buffer (50 mM Tris, 10% glycerol, 2% SDS, 0.01% bromophenol blue,
2.5% β-mercaptoethanol) at 107 cells/ml. Lysates were
denatured at 100°C and DNA was sheared with a 28 1/2 gauge insulin
needle. Lysate equivalent to 105 cells was resolved on 8% or 10%
SDS/PAGE (Life Technologies) and transferred to nitrocellulose membranes.
Membranes were blocked in 5% milk in TBS with 0.1% Tween-20 (TBS-T) and
incubated with primary antibody overnight at 4°C, washed 3 times in
TBS-T, and incubated for 1 h at room temperature with
horseradish-peroxidase-conjugated sheep anti-mouse or donkey anti-rabbit
secondary antibodies. After three washes in TBS-T, membranes were rinsed in TBS
and proteins were developed using enhanced chemiluminescence (Amersham).
The following primary antibodies were used: anti-APOBEC3B (rabbit
monoclonal, Abcam, ab184990, 1:1000), anti-γ-tubulin (mouse monoclonal,
Abcam, ab11316, 1:1000), anti-cGAS (Cell Signaling Technology, #15102; 1:1000),
anti-STING (Cell Signaling Technology, #13647, 1:1000).
Maciejowski J., Chatzipli A., Dananberg A., Chu K., Toufektchan E., Klimczak L.J., Gordenin D.A., Campbell P.J, & de Lange T. (2020). APOBEC3-dependent kataegis and TREX1-driven chromothripsis during telomere crisis. Nature genetics, 52(9), 884-890.
+ Open protocol
+ Expand
4

CRISPR Ablation of Innate Immune Sensors

Check if the same lab product or an alternative is used in the 5 most similar protocols
Efficacy for CRISPR/Cas9-mediated ablation of AIM2, caspase-1, STING, cGAS and IFI16 proteins in human THP-1 cells was evaluated by western blot. For AIM2 detection, control or AIM2 KO THP-1 cells were treated with human IFN-γ (75ng/ml, R&D System) or infected with Ad5 or ALVAC vector for 24 hours, followed by cell lysis in RIPA buffer (Cell Signaling). For detection of caspase-1, STING, cGAS and IFI16, control and KO THP-1 cells are directly lysed in RIPA buffer (Cell Signaling). Cell lysates were separated by 10% SDS-PAGE and transferred to PVDF membranes (Bio-rad). After blocking in 5% non-fat milk (TBS+0.1% Tween 20), membranes were incubated with anti-AIM2 antibody (1:500, Cell Signaling), anti-caspase-1 antibody (1:1000, Thermo Scientific), anti-STING antibody (1:1000, Cell Signaling), anti-cGAS (1:1000, Cell signaling), or anti-IFI16 (1:1000, Thermo Scientific) at 4°C overnight and developed with Rabbit IgG Horseradish Peroxidase-conjugated Antibody (1:1000, Cell Signaling) or mouse IgG Horseradish Peroxidase-conjugated Antibody (1:1000, Cell Signaling) and SuperSignal™ West Pico Chemiluminescent Substrate (Thermo Scientific). β-actin was also detected as control, using anti-β-actin antibody (1: 50,000, R&D System) for incubation at room temperature for 1 hour and then mouse IgG Horseradish Peroxidase-conjugated Antibody (1:3000, Cell Signaling) after striping.
Liu F., Niu Q., Fan X., Liu C., Zhang J., Wei Z., Hou W., Kanneganti T.D., Robb M.L., Kim J.H., Michael N.L., Sun J., Soong L, & Hu H. (2017). Priming and activation of inflammasome by canarypox virus vector ALVAC via the cGAS/IFI16-STING-Type I IFN pathway and AIM2 sensor. Journal of immunology (Baltimore, Md. : 1950), 199(9), 3293-3305.
+ Open protocol
+ Expand
5

Western Blot and TB Protein Analysis

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
For Western blot analysis, prepared WCL and nuclear fraction were denatured at 95°C for 10 min, separated by 12.5% SDS-PAGE gel. Proteins were transferred onto nitrocellulose membranes and blotted with rabbit anti-IRF3 (cat. A303-384A; Bethyl Laboratories Inc.), anti-IRF7 (cat. 3941; Prosci Inc.), anti-TBK1 (cat. 3504; Cell Signaling Technology), anti–phospho-TBK1 (Ser172; cat. 5483; Cell Signaling Technology), anti–RIG-I (cat. 3743; Cell Signaling Technology), anti–MDA-5 (cat. 5321; Cell Signaling Technology), anti-cGAS (cat. Sc-515777; SCBT), anti–β-actin (cat. 4970; Cell Signaling Technology), anti-MAVS (cat. Sc-365333; SCBT), anti-STING (cat. NBP2-24683SS), and anti-histone H3 (cat. 9717; Cell Signaling Technology) antibodies, followed by goat anti-rabbit IgG-HRP (cat. 31460; Thermo Scientific).
For M.tb culture supernatant proteins, M.tb strains were grown in Sauton’s liquid medium until midexponential phase, and culture supernatant fraction was prepared from 50 ml bacterial culture as described previously (Reyna et al., 2016 (link)). 10 µg of sample was loaded into 12% SDS-PAGE gel, and M.tb RNA polymerase subunit β (RNAP-β) and EsxB (CFP-10) proteins were probed using mouse anti–RNAP-β antibody (ab12087; Abcam) and rabbit anti-EsxB antibody (NR-13801; BEI Resources), respectively.
Cheng Y, & Schorey J.S. (2018). Mycobacterium tuberculosis–induced IFN-β production requires cytosolic DNA and RNA sensing pathways. The Journal of Experimental Medicine, 215(11), 2919-2935.
+ Open protocol
+ Expand
6

Western Blot Analysis of ISG, cGAS, and STING

Check if the same lab product or an alternative is used in the 5 most similar protocols
Western blot analysis was performed as previously described.13 Anti‐Myc (PL14; Medical & Biological Laboratories, Nagoya, Japan), anti‐ISG15 (H‐150; Santa Cruz Biotechnology, Dallas, TX, USA), anti‐ISG56, anti‐cGAS, anti‐phospho‐STING (Ser366), anti‐STING, anti‐phospho‐NF‐κB p65 (Ser536), anti‐NF‐κB p65 (Cell Signaling Technology, Beverly, MA, USA), and anti‐β‐actin (AC‐15; Sigma‐Aldrich, St. Louis, MO, USA) were used as primary antibodies.
Dansako H., Imai H., Ueda Y., Satoh S., Shimotohno K, & Kato N. (2018). High‐level expression of STING restricts susceptibility to HBV by mediating type III IFN induction. FASEB bioAdvances, 1(2), 67-80.
+ Open protocol
+ Expand
7

Immunofluorescence Analysis of Senescence Markers

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Fibroblasts in culture were seeded on coverslips and subsequently fixed with ice-cold 100% methanol at −20 °C for 10 min. Once fixated, the cells were blocked at 25 °C for 30 min in 10% FBS in PBS-T (0.2% Tween) and then incubated with the following primary antibodies: anti-p21 (MA5-14949, Invitrogen, Waltham, MA, USA, dilution 1:250), anti-lamin A/C (#E-1 sc-376248, Santa Cruz, dilution 1:2500), anti-cGAS (#15102, Cell Signaling, dilution 1:100), anti-progerin [56 (link)], anti-prelamin A (MABT858, Sigma-Aldrich, dilution 1:250), anti-P-H2A.X Ser139 (#05-636, Sigma-Aldrich, dilution 1:2000), and anti-lamin A (#L1293, Sigma-Aldrich, dilution 1:2000). After washing with PBS-T, the samples were incubated with the corresponding secondary antibodies at 25 °C for 1 h: affinity-purified Alexa Fluor 488 goat or donkey IgG antibodies (Life Technologies, Carlsbad, CA, USA) and Cy3-conjugated IgG antibodies (Jackson ImmunoResearch). All samples were counterstained with DAPI in Vectashield mounting medium (Vector Inc., Burlingame, CA, USA). Images were acquired using an Axio Imager D2 fluorescence microscope (AxioCam MRm, Objective 40× oil NA 1.4; Carl Zeiss, Oberkochen, Germany). For statistical evaluation, 800 to 1000 cells were screened in 3 independent experiments.
Arnold R., Vehns E., Randl H, & Djabali K. (2021). Baricitinib, a JAK-STAT Inhibitor, Reduces the Cellular Toxicity of the Farnesyltransferase Inhibitor Lonafarnib in Progeria Cells. International Journal of Molecular Sciences, 22(14), 7474.
+ Open protocol
+ Expand
8

Western Blot Analysis of Cellular Signaling Proteins

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cellular proteins were extracted with RIPA lysis buffer containing protease inhibitors and phosphatase inhibitors. Protein concentrations were measured by using a BCA protein assay kit (Thermo Fisher Scientific, USA). Protein samples were separated using 12.5% SDS-PAGE and transferred onto a polyvinylidenefluoride membrane (Millipore). Subsequently, membranes were blocked with 5% bovine serum albumin in PBS for 1 h and the appropriate antibodies at suitable concentrations were incubated overnight at 4 °C. The blots were then incubated with secondary antibodies at room temperature for 1 h. After extensive washing in TBST, protein bands were revealed with Super Singal West FemtoMaximum Sensitivity Substrate (Thermo Fisher Scientific, Rockford, USA) and visualized with Bio-Rad ChemiDocXRS system (Bio-Rad, USA). The primary antibodies were as follows: anti-GAPDH (Proteintech, 60004-1-lg), anti-p-ATM (Cell Signaling Technology, #5883), anti-p16 (Cell Signaling Technology, #80772), anti-p21 (Cell Signaling Technology, #2947), anti-cyclin E (Cell Signaling Technology, #4129), anti-cGAS (Cell Signaling Technology, #79978), anti-p-p53 (Cell Signaling Technology, #82530), anti-p-IRF3 (Cell Signaling Technology, #29047), anti-IRF3 (Cell Signaling Technology, #4302), anti-p-TBK1 (Cell Signaling Technology, #5483), and anti-TBK1 (Cell Signaling Technology, #3504).
Yang B., Xie X., Wu Z., Lv D., Hu J., Chen Y., Li J., Luo S., Li J., Luo J, & Zhang S. (2022). DNA damage-mediated cellular senescence promotes hand-foot syndrome that can be relieved by thymidine prodrug. Genes & Diseases, 10(6), 2557-2571.
+ Open protocol
+ Expand
9

Whole Cell Lysate Preparation and Immunoblotting

Check if the same lab product or an alternative is used in the 5 most similar protocols
To prepare whole cell lysates, cells were lysed in lysis buffer (10 mM HEPES, pH 7.9, 500 mM NaCl, 3 mM MgCl2, 1 mM DTT, 1 mM PMSF, 0.5% Triton X-100 supplemented with protease inhibitors). After 30 min of incubation on ice, whole cell lysates were centrifuged at 15,000× g for 10 min at 4 °C to remove the debris. Protein concentrations were determined using the Bradford assay. The protein samples were resolved on SDS-PAGE gels, transferred onto PVDF membranes and immunoblotted with specific primary antibodies as indicated in the figure legends. The primary antibodies used in this study include anti-STING (1:2000, 13647S, Cell Signaling Technology, Danvers, MA, USA), anti-cGAS (1:1000, 15102, Cell Signaling Technology), and anti-GAPDH (1:2000, 5174S, Cell Signaling Technology). The secondary antibody used was HRP-linked anti-rabbit IgG (1:3000, 7074S, Cell Signaling Technology). Western blots were developed using SuperSignal™ West Pico PLUS Chemiluminescent Substrate (Thermo Scientific, Waltham, MA, USA), and images were captured using a GE imaging system.
Liu W., Alameh M.G., Yang J.F., Xu J.R., Lin P.J., Tam Y.K., Weissman D, & You J. (2022). Lipid Nanoparticles Delivering Constitutively Active STING mRNA to Stimulate Antitumor Immunity. International Journal of Molecular Sciences, 23(23), 14504.
+ Open protocol
+ Expand
10

Investigating Inflammatory Signaling Pathways

Check if the same lab product or an alternative is used in the 5 most similar protocols
The phosphatase inhibitor cocktail and protease inhibitor cocktail were purchased from Sigma-Aldrich (St. Louis, MO, USA). The following antibodies were used: Anti-cGAS (#15102), anti-TBK1 (#3504S), anti-phospho-TBK1 (#5483), anti-IRF3 (#4302), anti-phospho-IRF3 (#4947), anti-α-Smooth Muscle Actin (D4K9N) (#19245), anti-GAPDH (D16H11) (#5174), Horseradish peroxidase (HRP)-conjugated goat anti-rabbit or anti-mouse IgG (all from Cell Signaling Technology, Danvers, MA, USA). Anti-Collagen I (ab6308)) and anti-Collagen III (ab184993) were both purchased from Abcam (Cambridge, MA, USA). The ReverTra Ace qPCR RT Kit (FSQ-101) and SYBR RT-PCR kit (QPK-212) were purchased from Toyobo (Osaka, Japan). LPS was purchased from Sigma-Aldrich. Immunostimulatory DNA (ISD, TACAGATCTACTAGTGATCTATGACTGATCTGTACATGATCTACA) was purchased from Invivogen (San Diego, CA, USA).
Liang L., Shen Y., Hu Y., Liu H, & Cao J. (2022). cGAS exacerbates Schistosoma japonicum infection in a STING-type I IFN-dependent and independent manner. PLoS Pathogens, 18(2), e1010233.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!