Superscript 2 first strand synthesis kit

For quantification of the mRNA expression, one μg of RNA was reverse-transcribed using the SuperScript II first strand synthesis kit (Invitrogen) and a mixture of random oligonucleotides and oligo-dT. Real-time PCR was performed using LightCycler480 (Roche) with 0.2 μM of each primer and 0.1 μM of the probe according to the protocol Absolute QPCR Rox Mix (ABgene). The primer pairs and Taqman probes used for the human α-sarcoglycan amplification were: 920hasarco. F:5′-TGCTGGCCTATGTCATGTGC-3′, 991hasarco. R:5′-TCTGGATGTCGGAGGTAGCC-3′, and 946hasarco. P:5′-CGGGAGGGAAGGCTGAAGAGAGACC-3′. The ubiquitous acidic ribosomal phosphoprotein (P0) was used to normalize the data across samples. The primer pairs and Taqman probe used for P0 amplification were: m181P0.F (5′-CTCCAAGCAGATGCAGCAGA-3′), m267P0.R (5′-ACCATGATGCGCAAGGCCAT-3′) and m225P0.P (5′-CCGTGGTGCTGATGGGCAAGAA-3′). The primer pairs and Taqman probes for the muscle endogenous transcripts were Mm01329494_m1 for the mouse myh8; Mm00434455_m1 for the mouse CD11b/Itgam and Mm00711678_m1 for the mouse COL6A3 transcripts (Thermo Fisher Scientific). Each experiment was performed in duplicate.

Total RNA was isolated with TRIZOL reagent (Sigma-Aldrich). cDNA was synthesized using the Superscript II First-Strand Synthesis kit (Invitrogen) according to the manufacturer’s protocol. Real-time PCR was carried out as described [16 (link)]. Primer sequences were as follows: TLR1 forward, CATTCCTGAGGTCCCTGCTA, reverse, GATGCACAGCTCCTTGGTTT; TLR2 forward, CACCAAGATCCAGAAGAGCC and reverse TAGGGGCTTCACTTCTCTGC; TLR3 forward, ACAAAAGTCCCCCAAAGGAG and reverse TGCAGTCTTTCCAGAGGGAT; TLR4 forward, TGTCATCAGGGACTTTGCTG and reverse GGACTCTGATCATGGCACTG; TLR5 forward, GCACAGAAAGCATGAAGCTG and reverse GCCTCTAAGGGCTCTCACCT; TLR6 forward, GAGGCTATCCCAGAGGGACT and reverse GAAGGCTTTTCTGGATTTTTCA; TLR7 forward, TGAGGGACTTCCCACTAACA and reverse TTGGCTTTGGACCCCAGTAG; TLR8 forward, CGCTTTATGGAAGATGGCAC and reverse TGGATGTTAAGAGAGAAACAAACG; TLR9 forward, GGCTTCAGCTCACAGGGTAG and reverse GAATCCTCCATCTCCCAACA; CIITA forward, TCAAGCACATTGGAGCAGAG and reverse AGGTCCTAGAGGTGGGCACT; UNC93B1 ATAGATGCCCACAGCCAAGA and reverse TGCTGATGGGTATCAACGTG; 18 s forward, CGGCTACCACATCCAAGGAA and reverse GCTGGAATTACCGCGGCT.

Total RNA was extracted from individual organs using a CTAB-based RNA isolation protocol in conjunction with a Plant RNA Mini Kit (Geneaid, Sijhih City, Taiwan) and the addition of DNase, according to the manufacturer’s instructions. The quality and quantity of the isolated RNA were determined using a NanoVue Plus spectrophotometer, and RNA integrity was assessed by running samples on a 1.0% denaturing agarose gel. Aliquots (1 μg) of the total RNA obtained from different plant parts was subjected to reverse transcription using a Superscript II First Strand Synthesis Kit (Invitrogen; Carlsbad, CA, USA) and oligo (dT)₂₀ primers according to the manufacturer’s protocol.