Peyfp n1
The PEYFP-N1 is a fluorescent protein expression vector developed by Takara Bio. It is designed to express enhanced yellow fluorescent protein (EYFP) in mammalian cells. The core function of this product is to provide a tool for the expression and visualization of EYFP in cellular studies.
Lab products found in correlation
65 protocols using peyfp n1
Cloning of Receptor Fusion Proteins
Establishing Doxorubicin-Resistant A549 and GPBP-Deficient 4T1 Cell Lines
A549 cells were cultured with 1 µM doxorubicin and the medium was changed every 48 h. When necessary the concentration of doxorubicin was lowered to 0.2 µM to prevent cell cycle arrest. After several weeks, doxorubicin IC50 was determined with alamarBlue® to confirm doxorubicin resistance (A549-DR).
4T1 cells were co-transfected with plasmids expressing Cas9 and a guide RNA (Sigma-Aldrich) targeting GPBP exclusive sequence in exon 11 (CCCTATAGTCGCTCTTCCTCCA) to generate 4T1 GPBP–/–.
Episomal Expression of CIITA Variants
Stable Transfection of Keratin-EYFP in MDCK and HaCaT Cells
Immortalized human HaCaT keratinocyte cell clone B10 expressing EYFP-tagged human keratin 5 (HK5-EYFP) has been described (Moch et al., 2013 (link)). HaCaT cells were obtained from the Fusenig lab, which first isolated and described this cell line (Boukamp et al., 1988 (link)). The cells were grown in DMEM containing l-alanyl-glutamine (Sigma-Aldrich) supplemented with 10% (v/v) fetal calf serum (SeraPlus; PAN Biotech) and passaged as described (Moch et al., 2013 (link)). Vital HaCaT cells were imaged 1–2 days after reaching confluence corresponding to 5–7 after seeding. Both cell lines were tested by PCR to be mycoplasma free.
Construction of Receptor-Fluorescent Protein Fusions
Fluorescent-tagged ion channel expression
Fluorescent Protein Constructs for AQP5
Calcium signaling regulation assays
Fluorescent β2-AR Mutagenesis and BRET
Fas-FRET for Receptor Oligomerization Analysis
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!