Ndufa9
NDUFA9 is a subunit of the mitochondrial respiratory complex I. It is involved in the oxidative phosphorylation process, which is responsible for the production of cellular energy in the form of ATP.
Lab products found in correlation
24 protocols using ndufa9
Quantitative Mitochondrial Protein Analysis
Western Blot Analysis of Hypoxia Proteins
Assessing Cellular Oxidative Stress and Viability
Mitochondrial Isolation from B Cells
following manufacturer's instructions with some modifications. Briefly, frozen B cells
(2–10 × 107 cells) were directly resuspended in pre-cooled phosphate-buffered
saline (1 ml per 108 total cells) supplemented with ethylenediamine tetraacetatic
acid (EDTA; 2 mM), anti-protease and –phosphatase inhibitors and benzonase
(50 U), and incubated for 20 min at 4 °C. Cell homogenization was performed
with a 26-G needle stepwise using 5–10 stokes. Lysates were diluted to 1 × separation
buffer (Miltenyi Biotec) and proceeded to magnetic labeling by incubation with anti-Tom22 magnetic
beads for 1 h at 4 °C on a wheel. The labeled cell lysate was loaded on a MACS
column placed in a magnetic field and let run through. Lysates were re-loaded three times. Column
was then intensively washed out and the magnetically labeled mitochondria were then flushed out.
Pre- and post-mitochondria-purified fractions were separated by SDS-PAGE and the presence of
cytoplasmic β-actin protein, Mt hsp60 or NDUFA9 proteins, and nuclear KDM1a were
evaluated by western blot analysis using monoclonal anti-β-actin (AC-15,
Sigma-Aldrich), -hsp60 (Biosciences Inc., Allentown, PA, USA), -NDUFA9 (Abcam, Cambridge, UK) and
KDM1a (Cell Signaling Technology).
STAT3 Knockdown and Mitochondrial Analysis
The following primers were used to check mitochondrial DNA copy no: mtDNA, Forward primer: CCTCCTCCTAGCAGCAGC, Reverse primer: GGTTGTGGATGATGGACCCG; HPRT, Forward primer: CCTGGGGATTCCAAATACCT, Reverse primer: GGGCAGAAAAGGTCATCAAA.
The following antibodies were used for immunoblotting: S727STAT3, STAT3 (Cell signaling, USA), GAPDH, β-actin, and VDAC-1 (Santa-Cruz, Dallas, TX), Y705STAT3, OXPHOS cocktail antibody, mtTFA, PGC1α, NDUFA9, GRIM19 (Abcam, Cambridge, UK), CD44, CD24, CD133 (BD Bioscience), FLAG, HA (Sigma-Aldrich, USA)
Hippocampal Mitochondrial Protein Expression
Mitochondrial and Autophagy Protein Detection
Western Blot Analysis of Cellular Signaling
Mitochondrial Proteome Analysis Protocol
Analyzing Mitochondrial Supercomplexes in Adipocytes
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!